Transcript: Mouse NM_001177899.1

Mus musculus src family associated phosphoprotein 1 (Skap1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Skap1 (78473)
Length:
2142
CDS:
115..1134

Additional Resources:

NCBI RefSeq record:
NM_001177899.1
NBCI Gene record:
Skap1 (78473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255054 AGAGACTGGGTGGATCAAATA pLKO_005 709 CDS 100% 13.200 18.480 N Skap1 n/a
2 TRCN0000255055 ATAGGCGCAGCTATGAGTTTA pLKO_005 665 CDS 100% 13.200 18.480 N Skap1 n/a
3 TRCN0000416504 GAGACTGGGTGGATCAAATAA pLKO_005 710 CDS 100% 15.000 10.500 N SKAP1 n/a
4 TRCN0000255057 ATGTACCGTGCCACATGTATA pLKO_005 1604 3UTR 100% 13.200 9.240 N Skap1 n/a
5 TRCN0000255056 GAGAGCTGAACAGCGTCATTG pLKO_005 1061 CDS 100% 10.800 7.560 N Skap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01973 pDONR223 100% 81.6% 77.9% None (many diffs) n/a
2 ccsbBroad304_01973 pLX_304 0% 81.6% 77.9% V5 (many diffs) n/a
3 TRCN0000475261 ATATCACTATGCGTGGTTATGCAA pLX_317 46% 81.6% 77.9% V5 (many diffs) n/a
Download CSV