Transcript: Human NM_001177998.2

Homo sapiens solute carrier family 34 member 2 (SLC34A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SLC34A2 (10568)
Length:
4112
CDS:
44..2113

Additional Resources:

NCBI RefSeq record:
NM_001177998.2
NBCI Gene record:
SLC34A2 (10568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001177998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045098 CGAGATCATAACCCAGCTTAT pLKO.1 763 CDS 100% 10.800 15.120 N SLC34A2 n/a
2 TRCN0000427282 GCCAACATTGGAACGTCAATC pLKO_005 602 CDS 100% 10.800 15.120 N SLC34A2 n/a
3 TRCN0000045101 CCTGAGACCTTTGATAACATA pLKO.1 2024 CDS 100% 5.625 7.875 N SLC34A2 n/a
4 TRCN0000045102 GCTCCCTGGATATTCTTAGTA pLKO.1 378 CDS 100% 5.625 7.875 N SLC34A2 n/a
5 TRCN0000045100 CCAGCATATCTTTGTGAATTT pLKO.1 1090 CDS 100% 13.200 9.240 N SLC34A2 n/a
6 TRCN0000427454 CTCATTGTCCAGCTGGATAAA pLKO_005 860 CDS 100% 13.200 9.240 N SLC34A2 n/a
7 TRCN0000425868 TGATTGGAATCGGCGTGATAA pLKO_005 1368 CDS 100% 13.200 9.240 N SLC34A2 n/a
8 TRCN0000422155 GCAACATCTCTGCCAAGTATC pLKO_005 1596 CDS 100% 10.800 7.560 N SLC34A2 n/a
9 TRCN0000045099 CCTGTAACCAAGATTGAACTT pLKO.1 170 CDS 100% 4.950 3.465 N SLC34A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02472 pDONR223 100% 99.9% 99.8% None 1898A>G n/a
2 ccsbBroad304_02472 pLX_304 0% 99.9% 99.8% V5 1898A>G n/a
3 TRCN0000476745 TCGGCATGTGTTTAAGATGTTTTA pLX_317 17.1% 99.9% 99.8% V5 1898A>G n/a
Download CSV