Transcript: Human NM_001178099.2

Homo sapiens zinc finger protein 182 (ZNF182), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF182 (7569)
Length:
3598
CDS:
363..2282

Additional Resources:

NCBI RefSeq record:
NM_001178099.2
NBCI Gene record:
ZNF182 (7569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107551 CCCGATAAACACGAATCATTT pLKO.1 831 CDS 100% 13.200 18.480 N ZNF182 n/a
2 TRCN0000107554 CACTCGGAAGTCAAAGTTCAT pLKO.1 2252 CDS 100% 4.950 3.960 N ZNF182 n/a
3 TRCN0000107553 GCTTCAATACAAAGACCCGAT pLKO.1 816 CDS 100% 2.160 1.728 N ZNF182 n/a
4 TRCN0000107552 CTGCTGATGCAAGTTGGATTT pLKO.1 711 CDS 100% 10.800 7.560 N ZNF182 n/a
5 TRCN0000107550 CCATAGATATAACAGTGGTAA pLKO.1 2633 3UTR 100% 4.950 3.465 N ZNF182 n/a
6 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 2139 CDS 100% 15.000 7.500 Y ZNF443 n/a
7 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 2139 CDS 100% 15.000 7.500 Y Zfp97 n/a
8 TRCN0000239829 AGGAGAGAAACCCTATGAATG pLKO_005 1637 CDS 100% 10.800 5.400 Y Gm14393 n/a
9 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 1970 CDS 100% 15.000 7.500 Y Zfp984 n/a
10 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 1634 CDS 100% 13.200 6.600 Y Gm14305 n/a
11 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1633 CDS 100% 10.800 5.400 Y Gm14308 n/a
12 TRCN0000016590 GCGAACTCATACAGGAGAGAA pLKO.1 1205 CDS 100% 4.950 2.475 Y ZNF649 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13984 pDONR223 100% 99.6% 99.8% None (many diffs) n/a
2 ccsbBroad304_13984 pLX_304 0% 99.6% 99.8% V5 (many diffs) n/a
Download CSV