Transcript: Human NM_001178102.2

Homo sapiens lysyl oxidase (LOX), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
LOX (4015)
Length:
4407
CDS:
282..845

Additional Resources:

NCBI RefSeq record:
NM_001178102.2
NBCI Gene record:
LOX (4015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293898 AGACTGCCAGTGGATTGATAT pLKO_005 668 CDS 100% 13.200 18.480 N LOX n/a
2 TRCN0000045990 CTGCACAATTTCACCGTATTA pLKO.1 824 CDS 100% 13.200 18.480 N LOX n/a
3 TRCN0000286463 CTGCACAATTTCACCGTATTA pLKO_005 824 CDS 100% 13.200 18.480 N LOX n/a
4 TRCN0000011850 GCTGCACAATTTCACCGTATT pLKO.1 823 CDS 100% 10.800 15.120 N Lox n/a
5 TRCN0000321076 GCTGCACAATTTCACCGTATT pLKO_005 823 CDS 100% 10.800 15.120 N Lox n/a
6 TRCN0000045988 CCTGGCTGTTATGATACCTAT pLKO.1 636 CDS 100% 4.950 6.930 N LOX n/a
7 TRCN0000293943 GACTAACTTCAGTAGGATTTA pLKO_005 908 3UTR 100% 13.200 9.240 N LOX n/a
8 TRCN0000045989 CCAAGGGACATCAGATTTCTT pLKO.1 404 CDS 100% 5.625 3.938 N LOX n/a
9 TRCN0000286531 CCAAGGGACATCAGATTTCTT pLKO_005 404 CDS 100% 5.625 3.938 N LOX n/a
10 TRCN0000045992 GTCATCAACATTACCACAGTA pLKO.1 463 CDS 100% 4.950 2.970 N LOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00948 pDONR223 100% 44.8% 44.8% None 0_1ins690 n/a
2 TRCN0000477950 CTAATTATTTTGGGTCCGCAGTTC pLX_317 37.2% 44.8% 44.8% V5 0_1ins690 n/a
Download CSV