Transcript: Human NM_001178112.2

Homo sapiens secretory carrier membrane protein 5 (SCAMP5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SCAMP5 (192683)
Length:
3429
CDS:
210..917

Additional Resources:

NCBI RefSeq record:
NM_001178112.2
NBCI Gene record:
SCAMP5 (192683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416276 CCCAATTACACGTACTCCAAT pLKO_005 888 CDS 100% 4.950 6.930 N SCAMP5 n/a
2 TRCN0000105536 GCCATGTTTCTACCAAGACTT pLKO.1 263 CDS 100% 4.950 3.960 N Scamp5 n/a
3 TRCN0000149276 GCCATGTTTCTACCAAGACTT pLKO.1 263 CDS 100% 4.950 3.960 N SCAMP5 n/a
4 TRCN0000325775 GCCATGTTTCTACCAAGACTT pLKO_005 263 CDS 100% 4.950 3.960 N Scamp5 n/a
5 TRCN0000413585 ACAAAGGACCAGAGTTATATA pLKO_005 1037 3UTR 100% 15.000 10.500 N SCAMP5 n/a
6 TRCN0000147175 CTTCAGTTTCATGGCATTCTT pLKO.1 515 CDS 100% 5.625 3.938 N SCAMP5 n/a
7 TRCN0000438190 CAACTTTGGCCTCGCCTTTCT pLKO_005 416 CDS 100% 4.950 3.465 N SCAMP5 n/a
8 TRCN0000149259 GATGCTAATTCCCACTGTCAT pLKO.1 659 CDS 100% 4.950 3.465 N SCAMP5 n/a
9 TRCN0000105538 GCCCATTTACAAGGCCTTCAA pLKO.1 482 CDS 100% 4.950 3.465 N Scamp5 n/a
10 TRCN0000325707 GCCCATTTACAAGGCCTTCAA pLKO_005 482 CDS 100% 4.950 3.465 N Scamp5 n/a
11 TRCN0000431501 TTCACAGTGATGGCCGTCTTT pLKO_005 681 CDS 100% 4.950 3.465 N SCAMP5 n/a
12 TRCN0000148517 CCACATCGTCATTTGTGGTTA pLKO.1 973 3UTR 100% 0.495 0.347 N SCAMP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05167 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05167 pLX_304 0% 100% 100% V5 n/a
Download CSV