Transcript: Human NM_001178146.2

Homo sapiens immunoglobulin superfamily member 10 (IGSF10), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
IGSF10 (285313)
Length:
5157
CDS:
154..1962

Additional Resources:

NCBI RefSeq record:
NM_001178146.2
NBCI Gene record:
IGSF10 (285313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141835 GCATCAGTGGAGAATCTCTAT pLKO.1 1421 CDS 100% 4.950 3.960 N IGSF10 n/a
2 TRCN0000418957 AGGAATAAAGTTGGCTATATT pLKO_005 1330 CDS 100% 15.000 10.500 N IGSF10 n/a
3 TRCN0000140565 GCTTTCAGATTCAGCCGACTT pLKO.1 1002 CDS 100% 4.050 2.835 N IGSF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09976 pDONR223 100% 99.8% 99.8% None 528T>G;665A>G;1620A>G n/a
2 ccsbBroad304_09976 pLX_304 0% 99.8% 99.8% V5 528T>G;665A>G;1620A>G n/a
3 TRCN0000474048 CAATTTGGGCATCGCGCACCGAAA pLX_317 20.3% 99.8% 99.8% V5 528T>G;665A>G;1620A>G n/a
Download CSV