Transcript: Human NM_001184717.1

Homo sapiens TCDD inducible poly(ADP-ribose) polymerase (TIPARP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TIPARP (25976)
Length:
4132
CDS:
508..2481

Additional Resources:

NCBI RefSeq record:
NM_001184717.1
NBCI Gene record:
TIPARP (25976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219479 TGACCAGAGTTACCCTTATTT pLKO.1 2418 CDS 100% 15.000 21.000 N Tiparp n/a
2 TRCN0000004466 CCTTACTTACACTACTTACTT pLKO.1 3506 3UTR 100% 5.625 7.875 N TIPARP n/a
3 TRCN0000284930 AGGTCTTTGAGGCCAATATTA pLKO_005 667 CDS 100% 15.000 10.500 N TIPARP n/a
4 TRCN0000219478 GTTTGGACAAGGCAGTTATTT pLKO.1 2181 CDS 100% 15.000 10.500 N Tiparp n/a
5 TRCN0000273168 GTTTGGACAAGGCAGTTATTT pLKO_005 2181 CDS 100% 15.000 10.500 N TIPARP n/a
6 TRCN0000284932 TAGCAATGTCAACTCTATTTA pLKO_005 1515 CDS 100% 15.000 10.500 N TIPARP n/a
7 TRCN0000004462 GAAGGCAAGCTACTCTCATAA pLKO.1 2208 CDS 100% 13.200 9.240 N TIPARP n/a
8 TRCN0000273169 GAAGGCAAGCTACTCTCATAA pLKO_005 2208 CDS 100% 13.200 9.240 N TIPARP n/a
9 TRCN0000273097 GAGCAATGTGAGGATTCTATT pLKO_005 2855 3UTR 100% 13.200 9.240 N TIPARP n/a
10 TRCN0000004463 CTTCCATATTTACAGACACTT pLKO.1 1741 CDS 100% 4.950 3.465 N TIPARP n/a
11 TRCN0000004465 CTTGTATTTATGGCAGGGATT pLKO.1 1256 CDS 100% 4.050 2.835 N TIPARP n/a
12 TRCN0000004464 GAACCAGAGTACAGATGAGAA pLKO.1 735 CDS 100% 4.950 2.970 N TIPARP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.