Transcript: Human NM_001184718.1

Homo sapiens TCDD inducible poly(ADP-ribose) polymerase (TIPARP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TIPARP (25976)
Length:
3697
CDS:
73..2046

Additional Resources:

NCBI RefSeq record:
NM_001184718.1
NBCI Gene record:
TIPARP (25976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219479 TGACCAGAGTTACCCTTATTT pLKO.1 1983 CDS 100% 15.000 21.000 N Tiparp n/a
2 TRCN0000004466 CCTTACTTACACTACTTACTT pLKO.1 3071 3UTR 100% 5.625 7.875 N TIPARP n/a
3 TRCN0000284930 AGGTCTTTGAGGCCAATATTA pLKO_005 232 CDS 100% 15.000 10.500 N TIPARP n/a
4 TRCN0000219478 GTTTGGACAAGGCAGTTATTT pLKO.1 1746 CDS 100% 15.000 10.500 N Tiparp n/a
5 TRCN0000273168 GTTTGGACAAGGCAGTTATTT pLKO_005 1746 CDS 100% 15.000 10.500 N TIPARP n/a
6 TRCN0000284932 TAGCAATGTCAACTCTATTTA pLKO_005 1080 CDS 100% 15.000 10.500 N TIPARP n/a
7 TRCN0000004462 GAAGGCAAGCTACTCTCATAA pLKO.1 1773 CDS 100% 13.200 9.240 N TIPARP n/a
8 TRCN0000273169 GAAGGCAAGCTACTCTCATAA pLKO_005 1773 CDS 100% 13.200 9.240 N TIPARP n/a
9 TRCN0000273097 GAGCAATGTGAGGATTCTATT pLKO_005 2420 3UTR 100% 13.200 9.240 N TIPARP n/a
10 TRCN0000004463 CTTCCATATTTACAGACACTT pLKO.1 1306 CDS 100% 4.950 3.465 N TIPARP n/a
11 TRCN0000004465 CTTGTATTTATGGCAGGGATT pLKO.1 821 CDS 100% 4.050 2.835 N TIPARP n/a
12 TRCN0000004464 GAACCAGAGTACAGATGAGAA pLKO.1 300 CDS 100% 4.950 2.970 N TIPARP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.