Transcript: Human NM_001184739.2

Homo sapiens testis specific serine kinase 4 (TSSK4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TSSK4 (283629)
Length:
1347
CDS:
229..1245

Additional Resources:

NCBI RefSeq record:
NM_001184739.2
NBCI Gene record:
TSSK4 (283629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194722 CATTCCCTCATGGATGAATAT pLKO.1 277 CDS 100% 13.200 18.480 N TSSK4 n/a
2 TRCN0000010698 TGCTGCTGGTAGGGACTTAAA pLKO.1 687 CDS 100% 13.200 18.480 N TSSK4 n/a
3 TRCN0000196985 GTCGGTATATGAGGCTTTCTA pLKO.1 339 CDS 100% 5.625 7.875 N TSSK4 n/a
4 TRCN0000002414 CGTCATCCTTTACACTCTAGT pLKO.1 936 CDS 100% 4.950 6.930 N TSSK4 n/a
5 TRCN0000195194 CGAGTATACATCATTCTGGAA pLKO.1 517 CDS 100% 2.640 3.696 N TSSK4 n/a
6 TRCN0000002416 CAGCTCCACAACACCACTAAA pLKO.1 1195 CDS 100% 13.200 9.240 N TSSK4 n/a
7 TRCN0000194980 CATGGATGAATATGGTTATGA pLKO.1 285 CDS 100% 5.625 3.938 N TSSK4 n/a
8 TRCN0000002417 ACACCACTAAACAGCACCAAT pLKO.1 1205 CDS 100% 4.950 3.465 N TSSK4 n/a
9 TRCN0000199460 GCGGCACAAGTACCTCATCAA pLKO.1 468 CDS 100% 4.950 3.465 N TSSK4 n/a
10 TRCN0000199342 CCAGAGATCTTACGAGGCTTG pLKO.1 877 CDS 100% 2.250 1.575 N TSSK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13502 pDONR223 100% 74.5% 74.5% None 1_228del;440_469del n/a
2 ccsbBroad304_13502 pLX_304 0% 74.5% 74.5% V5 1_228del;440_469del n/a
3 TRCN0000474270 ACCTGAGATACATACTTGTATTAA pLX_317 29.7% 74.5% 74.5% V5 1_228del;440_469del n/a
Download CSV