Construct: ORF TRCN0000474270
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017788.1_s317c1
- Derived from:
- ccsbBroadEn_13502
- DNA Barcode:
- ACCTGAGATACATACTTGTATTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TSSK4 (283629)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474270
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 283629 | TSSK4 | testis specific serine kina... | NM_001308067.2 | 100% | 100% | |
| 2 | human | 283629 | TSSK4 | testis specific serine kina... | XM_011536663.2 | 96.1% | 96.1% | 212_241del |
| 3 | human | 283629 | TSSK4 | testis specific serine kina... | XM_024449544.1 | 81.6% | 75.4% | (many diffs) |
| 4 | human | 283629 | TSSK4 | testis specific serine kina... | XM_024449543.1 | 78.5% | 72.6% | (many diffs) |
| 5 | human | 283629 | TSSK4 | testis specific serine kina... | NM_174944.4 | 76.8% | 76.8% | 1_228del |
| 6 | human | 283629 | TSSK4 | testis specific serine kina... | NM_001184739.2 | 74.5% | 74.5% | 1_228del;440_469del |
| 7 | human | 283629 | TSSK4 | testis specific serine kina... | XM_024449542.1 | 61% | 56.7% | (many diffs) |
| 8 | mouse | 71099 | Tssk4 | testis-specific serine kina... | XM_006519551.3 | 84.6% | 81.9% | (many diffs) |
| 9 | mouse | 71099 | Tssk4 | testis-specific serine kina... | XM_006519552.1 | 73.8% | 64.4% | (many diffs) |
| 10 | mouse | 71099 | Tssk4 | testis-specific serine kina... | NM_027673.3 | 68.6% | 66.4% | (many diffs) |
| 11 | mouse | 71099 | Tssk4 | testis-specific serine kina... | NM_001253888.1 | 66.6% | 64.4% | (many diffs) |
| 12 | mouse | 71099 | Tssk4 | testis-specific serine kina... | NM_001253889.1 | 54.6% | 52% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 825
- ORF length:
- 756
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaaagtcttg cggcacaagt acctcatcaa cttctatcgg gccattgaga 121 gcacatctcg agtatacatc attctggaac tggctcaggg tggtgatgtc cttgaatgga 181 tccagcgcta cggggcctgc tctgagcccc ttgctggcaa gtggttctcc cagctgaccc 241 tgggcattgc ctacctgcac agcaagagca tcgtgcaccg ggacttaaag ttggagaacc 301 tgttgctgga caagtgggag aatgtgaaga tatcagactt tggctttgcc aagatggtgc 361 cttctaacca gcctgtgggt tgtagccctt cttaccgcca agtgaactgc ttttcccacc 421 tcagccagac ttactgtggc agctttgctt acgcttgccc agagatctta cgaggcttgc 481 cctacaaccc tttcctgtct gacacctgga gcatgggcgt catcctttac actctagtgg 541 tcgcccatct gccctttgat gacaccaatc tcaaaaagct gctaagagag actcagaagg 601 aggTCACTTT CCCAGCTAAC CATACCATCT CCCAGGAGTG CAAGAACCTG ATCCTCCAGA 661 TGCTACGCCA AGCCACTAAG CGTGCCACCA TTCTGGACAT CATCAAGGAT TCCTGGGTGC 721 TCAAGTTCCA GCCTGAGCAA CCCACCCATG AGATCAGGCT GCTTGAGGCC ATGTGCCAGC 781 TCCACAACAC CACTAAACAG CACCAATCCT TGCAAATTAC GACCTTGCCA ACTTTCTTGT 841 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 901 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 961 GAAAGGACGA ACCTGAGATA CATACTTGTA TTAAACGCGT TAAGTCgaca atcaacctct 1021 ggattacaaa atttgtgaaa gatt