Transcript: Human NM_001184746.2

Homo sapiens platelet activating factor acetylhydrolase 1b catalytic subunit 2 (PAFAH1B2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PAFAH1B2 (5049)
Length:
1664
CDS:
140..748

Additional Resources:

NCBI RefSeq record:
NM_001184746.2
NBCI Gene record:
PAFAH1B2 (5049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230674 ATATTAAGCCTAAGGTCATTG pLKO_005 414 CDS 100% 10.800 15.120 N PAFAH1B2 n/a
2 TRCN0000048792 GTAGGAACAAATAACCACGAA pLKO.1 443 CDS 100% 2.640 2.112 N PAFAH1B2 n/a
3 TRCN0000218778 TGTCTGGGTAGGAACAAATAA pLKO_005 436 CDS 100% 15.000 10.500 N PAFAH1B2 n/a
4 TRCN0000048788 CCCACTTCATGCACTGAATTT pLKO.1 331 CDS 100% 13.200 9.240 N PAFAH1B2 n/a
5 TRCN0000230673 GTGCAGTTAATGCAGCAATAT pLKO_005 287 CDS 100% 13.200 9.240 N PAFAH1B2 n/a
6 TRCN0000048790 TGGTGCAGTTAATGCAGCAAT pLKO.1 285 CDS 100% 4.950 2.970 N PAFAH1B2 n/a
7 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1384 3UTR 100% 4.950 2.475 Y GJD4 n/a
8 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1384 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01142 pDONR223 100% 73.5% 57.6% None (many diffs) n/a
2 ccsbBroad304_01142 pLX_304 0% 73.5% 57.6% V5 (many diffs) n/a
3 TRCN0000471676 GGAACTCCACTAATAATCTAGCCA pLX_317 56.7% 73.5% 57.6% V5 (many diffs) n/a
Download CSV