Transcript: Human NM_001184749.3

Homo sapiens SLIT and NTRK like family member 4 (SLITRK4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLITRK4 (139065)
Length:
8736
CDS:
418..2931

Additional Resources:

NCBI RefSeq record:
NM_001184749.3
NBCI Gene record:
SLITRK4 (139065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412381 GAAACCACCTTGGTCTAATTT pLKO_005 579 CDS 100% 15.000 21.000 N SLITRK4 n/a
2 TRCN0000424336 GTGATTAAGGGAGACGTATTT pLKO_005 1660 CDS 100% 13.200 18.480 N SLITRK4 n/a
3 TRCN0000078626 GCCCTGATTTCTTCGACAAAT pLKO.1 448 CDS 100% 13.200 10.560 N SLITRK4 n/a
4 TRCN0000078627 GCCGACAAGGAGAAAGATTTA pLKO.1 2590 CDS 100% 13.200 10.560 N SLITRK4 n/a
5 TRCN0000424390 CTTCATACAGAGGACATTTAT pLKO_005 2946 3UTR 100% 15.000 10.500 N SLITRK4 n/a
6 TRCN0000426831 GGATGCTTTATACACATAATA pLKO_005 3171 3UTR 100% 15.000 10.500 N SLITRK4 n/a
7 TRCN0000078623 CGTCTCTTTGTGCTTTGTAAA pLKO.1 3244 3UTR 100% 13.200 9.240 N SLITRK4 n/a
8 TRCN0000078624 GCCTTCAATAAGCTCCACAAA pLKO.1 865 CDS 100% 4.950 3.465 N SLITRK4 n/a
9 TRCN0000078797 GCTGACACTTTCCTTGGCATA pLKO.1 787 CDS 100% 4.050 2.835 N Slitrk4 n/a
10 TRCN0000078625 GCTGTGATTTATTGCCCTTAA pLKO.1 1070 CDS 100% 10.800 6.480 N SLITRK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09576 pDONR223 100% 99.8% 100% None (many diffs) n/a
2 ccsbBroad304_09576 pLX_304 0% 99.8% 100% V5 (many diffs) n/a
3 TRCN0000479202 GGACGCAGTTTAATACCGAACCGT pLX_317 15% 99.8% 100% V5 (many diffs) n/a
Download CSV