Transcript: Human NM_001184797.2

Homo sapiens trimethyllysine hydroxylase, epsilon (TMLHE), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TMLHE (55217)
Length:
1323
CDS:
163..1293

Additional Resources:

NCBI RefSeq record:
NM_001184797.2
NBCI Gene record:
TMLHE (55217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064804 GCACACTGACACTACCTATTT pLKO.1 885 CDS 100% 13.200 18.480 N TMLHE n/a
2 TRCN0000064806 CCAAAGACCATTCGTCTGGAT pLKO.1 478 CDS 100% 2.640 3.696 N TMLHE n/a
3 TRCN0000064807 CGCTTTGATTACGTCTGGCTT pLKO.1 370 CDS 100% 2.640 3.696 N TMLHE n/a
4 TRCN0000064803 CCTCAGTAAAGTGCCATTGAA pLKO.1 1035 CDS 100% 5.625 3.938 N TMLHE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03551 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03551 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469125 GCATAAAGATCGCATCCGCGAGCT pLX_317 33.6% 100% 100% V5 n/a
Download CSV