Transcript: Human NM_001185106.1

Homo sapiens phosphatidylinositol specific phospholipase C X domain containing 2 (PLCXD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
PLCXD2 (257068)
Length:
2148
CDS:
571..1488

Additional Resources:

NCBI RefSeq record:
NM_001185106.1
NBCI Gene record:
PLCXD2 (257068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001185106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078249 GCGCAAACTAATCCTCTTCTT pLKO.1 1290 CDS 100% 4.950 6.930 N PLCXD2 n/a
2 TRCN0000425670 CATTTCGGTGAGAACTTTATT pLKO_005 1630 3UTR 100% 15.000 12.000 N PLCXD2 n/a
3 TRCN0000078250 GCTGATGGAAATTGACTCGTT pLKO.1 996 CDS 100% 2.640 2.112 N PLCXD2 n/a
4 TRCN0000414128 ACCAAACCCAAGCTATCAAAC pLKO_005 788 CDS 100% 10.800 7.560 N PLCXD2 n/a
5 TRCN0000078252 CTGGATTTCAACCACTTCTAT pLKO.1 1048 CDS 100% 5.625 3.938 N PLCXD2 n/a
6 TRCN0000078248 CCCAGTGACTCATCAGTCATT pLKO.1 1912 3UTR 100% 0.495 0.347 N PLCXD2 n/a
7 TRCN0000078251 CCTGGATTTCAACCACTTCTA pLKO.1 1047 CDS 100% 4.950 2.970 N PLCXD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001185106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05319 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05319 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468804 GGCATGATTCGCAAACTCTATAGT pLX_317 29.6% 100% 100% V5 n/a
Download CSV