Transcript: Mouse NM_001190344.1

Mus musculus cerebral cavernous malformation 2 (Ccm2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ccm2 (216527)
Length:
1760
CDS:
218..1387

Additional Resources:

NCBI RefSeq record:
NM_001190344.1
NBCI Gene record:
Ccm2 (216527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198373 GACATGAAGGACAGTTACGAT pLKO.1 791 CDS 100% 3.000 2.400 N Ccm2 n/a
2 TRCN0000199002 GCAGAAACCTCTGTGCCTATT pLKO.1 1575 3UTR 100% 10.800 7.560 N Ccm2 n/a
3 TRCN0000177414 GCATGATTTCAGACATCAGTA pLKO.1 1320 CDS 100% 4.950 3.465 N Ccm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04281 pDONR223 100% 74.3% 78.1% None (many diffs) n/a
2 ccsbBroad304_04281 pLX_304 0% 74.3% 78.1% V5 (many diffs) n/a
3 TRCN0000469977 AAGTACGCAATTACATCCAACGAA pLX_317 25.2% 74.3% 78.1% V5 (many diffs) n/a
Download CSV