Transcript: Mouse NM_001190403.1

Mus musculus amylase 2b (Amy2b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Amy2b (545562)
Length:
1413
CDS:
18..1379

Additional Resources:

NCBI RefSeq record:
NM_001190403.1
NBCI Gene record:
Amy2b (545562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256686 CAATGTTGGTGTCCGTATTTA pLKO_005 323 CDS 100% 15.000 7.500 Y Amy2a5 n/a
2 TRCN0000250553 CTGGGTGGTGAGGCAATTAAA pLKO_005 597 CDS 100% 15.000 7.500 Y Amy2a5 n/a
3 TRCN0000250554 CTTGGGACTTTAACGATAATA pLKO_005 460 CDS 100% 15.000 7.500 Y Amy2a5 n/a
4 TRCN0000347951 TGGGACTTTAACGATAATAAA pLKO_005 462 CDS 100% 15.000 7.500 Y Amy2a2 n/a
5 TRCN0000348025 TTACCGTTGGAATAGAAATTT pLKO_005 911 CDS 100% 15.000 7.500 Y Amy2a3 n/a
6 TRCN0000255969 TTGGGACTTTAACGATAATAA pLKO_005 461 CDS 100% 15.000 7.500 Y Amy2a5 n/a
7 TRCN0000250555 ACAATGTTGGTGTCCGTATTT pLKO_005 322 CDS 100% 13.200 6.600 Y Amy2a5 n/a
8 TRCN0000348030 ACTCTGCTGAGGACCCATTTA pLKO_005 1330 CDS 100% 13.200 6.600 Y Amy2a2 n/a
9 TRCN0000255967 GAGTGGCGCTGGGTTGATATT pLKO_005 114 CDS 100% 13.200 6.600 Y Amy2a5 n/a
10 TRCN0000176801 GATGCTTATCAGGTCAGAAAT pLKO.1 510 CDS 100% 13.200 6.600 Y Amy2a5 n/a
11 TRCN0000256690 GCTTGGGACTTTAACGATAAT pLKO_005 459 CDS 100% 13.200 6.600 Y Amy2a5 n/a
12 TRCN0000255968 GGGTTCTGCTGGGCTCAATAT pLKO_005 48 CDS 100% 13.200 6.600 Y Amy2a5 n/a
13 TRCN0000348026 CAGATGGGAGGACTGCTATTG pLKO_005 82 CDS 100% 10.800 5.400 Y Amy2a3 n/a
14 TRCN0000348028 TGCTTGGGACTTTAACGATAA pLKO_005 458 CDS 100% 10.800 5.400 Y Amy2a3 n/a
15 TRCN0000348029 TGGTGACAAGGTGCAACAATG pLKO_005 307 CDS 100% 10.800 5.400 Y Amy2a2 n/a
16 TRCN0000348031 TTAAAGGTAGTGAGTACTTTG pLKO_005 613 CDS 100% 10.800 5.400 Y Amy2a2 n/a
17 TRCN0000181494 GCAACAATGTTGGTGTCCGTA pLKO.1 319 CDS 100% 2.640 1.320 Y Amy2a5 n/a
18 TRCN0000056025 GCACATACTGTGATGTCATTT pLKO.1 1228 CDS 100% 13.200 6.600 Y AMY2A n/a
19 TRCN0000151403 GCACATACTGTGATGTCATTT pLKO.1 1228 CDS 100% 13.200 6.600 Y AMY1C n/a
20 TRCN0000056026 CGTATTTATGTGGATGCTGTA pLKO.1 336 CDS 100% 4.050 2.025 Y AMY2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00065 pDONR223 100% 74.9% 76.1% None (many diffs) n/a
2 ccsbBroad304_00065 pLX_304 0% 74.9% 76.1% V5 (many diffs) n/a
3 TRCN0000472453 AACGACGCGTATCCGTTCGTTCAA pLX_317 30.1% 74.9% 76.1% V5 (many diffs) n/a
4 ccsbBroadEn_05813 pDONR223 100% 74.5% 75.9% None (many diffs) n/a
5 ccsbBroad304_05813 pLX_304 0% 74.5% 75.9% V5 (many diffs) n/a
6 TRCN0000471163 CACTTCGGTCTGCGCATCTCCTTG pLX_317 27.3% 74.5% 75.9% V5 (many diffs) n/a
Download CSV