Transcript: Human NM_001190848.1

Homo sapiens CCR4-NOT transcription complex subunit 4 (CNOT4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CNOT4 (4850)
Length:
3783
CDS:
332..2059

Additional Resources:

NCBI RefSeq record:
NM_001190848.1
NBCI Gene record:
CNOT4 (4850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234729 ACAGAGTCACAGTCGTTATTC pLKO_005 1322 CDS 100% 13.200 18.480 N CNOT4 n/a
2 TRCN0000234727 TCGTCTTTGTTGTAGGTTTAT pLKO_005 660 CDS 100% 13.200 18.480 N CNOT4 n/a
3 TRCN0000234726 GGCTACCAGATTTGCCGATTT pLKO_005 431 CDS 100% 10.800 8.640 N CNOT4 n/a
4 TRCN0000015217 CGGTGATAATTCCCAGCAGAT pLKO.1 1192 CDS 100% 4.050 3.240 N CNOT4 n/a
5 TRCN0000234728 CAGTATAGGGAACGGTGATAA pLKO_005 1180 CDS 100% 13.200 9.240 N CNOT4 n/a
6 TRCN0000015216 GCCCTTGGAGATAGATGATAT pLKO.1 388 CDS 100% 13.200 9.240 N CNOT4 n/a
7 TRCN0000015214 CCAGTGCTTATGTAACCTATA pLKO.1 801 CDS 100% 10.800 7.560 N CNOT4 n/a
8 TRCN0000015215 GCCTCTTCACATCAGAAACAA pLKO.1 1446 CDS 100% 5.625 3.938 N CNOT4 n/a
9 TRCN0000084992 CCCATTGACAAACCTTCAGAT pLKO.1 1154 CDS 100% 4.950 3.465 N Cnot4 n/a
10 TRCN0000321591 GCACCTGTGGCTACCAGATAT pLKO_005 423 CDS 100% 13.200 9.240 N Cnot4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06649 pDONR223 100% 99.4% 99.1% None 813_821delGTACGATAC;1019A>T n/a
2 ccsbBroad304_06649 pLX_304 0% 99.4% 99.1% V5 813_821delGTACGATAC;1019A>T n/a
3 TRCN0000477893 GTGAGGCCTCGTTTGACCTCTCAA pLX_317 21.6% 99.4% 99.1% V5 813_821delGTACGATAC;1019A>T n/a
Download CSV