Construct: ORF TRCN0000477893
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018055.1_s317c1
- Derived from:
- ccsbBroadEn_06649
- DNA Barcode:
- GTGAGGCCTCGTTTGACCTCTCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CNOT4 (4850)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477893
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | NM_001008225.2 | 99.9% | 99.8% | 1010A>T |
| 2 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | NM_001190848.1 | 99.4% | 99.1% | 813_821delGTACGATAC;1019A>T |
| 3 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | NM_013316.4 | 87.3% | 84.6% | (many diffs) |
| 4 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | XM_024446772.1 | 87.3% | 84.6% | (many diffs) |
| 5 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | NM_001190847.2 | 86.9% | 84.1% | (many diffs) |
| 6 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | NM_001190849.2 | 78.6% | 75.4% | (many diffs) |
| 7 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | NM_001190850.1 | 78.3% | 74.9% | (many diffs) |
| 8 | human | 4850 | CNOT4 | CCR4-NOT transcription comp... | XM_017012235.1 | 78.3% | 74.9% | (many diffs) |
| 9 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | NM_001164411.1 | 94.6% | 98.6% | (many diffs) |
| 10 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | NM_016877.4 | 94.2% | 97.9% | (many diffs) |
| 11 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | NM_001164412.1 | 82% | 83.4% | (many diffs) |
| 12 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | NM_001164414.1 | 81.6% | 82.9% | (many diffs) |
| 13 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | NM_001164413.1 | 74.6% | 75.9% | (many diffs) |
| 14 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | XM_011241407.1 | 74.3% | 75.4% | (many diffs) |
| 15 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | XM_011241408.2 | 74.3% | 75.4% | (many diffs) |
| 16 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | XR_001785153.1 | 6.3% | (many diffs) | |
| 17 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | XR_001785151.1 | 6.3% | (many diffs) | |
| 18 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | XR_001785152.1 | 6.3% | (many diffs) | |
| 19 | mouse | 53621 | Cnot4 | CCR4-NOT transcription comp... | XR_001785150.1 | 6.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1782
- ORF length:
- 1716
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tcgcagtcct gatgcgaagg aagaccctgt ggagtgccct ctttgcatgg 121 agcccttgga gatagatgat atcaactttt tcccttgcac ctgtggctac cagatttgcc 181 gattttgttg gcatcgaatt cgcactgatg aaaatgggct ttgtcctgca tgtagaaagc 241 catatccaga agacccagca gtttataaac cactctccca ggaagagctg caaaggataa 301 agaatgagaa aaaacagaaa caaaatgaga gaaaacagaa aatatcagaa aatcgcaaac 361 atttggctag tgtacgtgtc gtacaaaaaa acctcgtctt tgttgtaggt ttatctcagc 421 gcctagcaga cccagaggtt ttaaaacgac cagaatattt tgggaagttt ggtaaaatac 481 ataaagttgt catcaataat agcacatcat atgcaggctc acagggtcca agtgccagtg 541 cttatgtaac ctatatccgg tcagaagacg ctctcagagc catacagtgt gtcaacaatg 601 tggtagtaga tggcagaaca cttaaggcat ctctaggtac aacaaaatac tgcagttact 661 tcttaaagaa tatgcagtgt ccaaaacctg actgcatgta tcttcatgaa ttgggggatg 721 aggcggccag cttcacaaaa gaggaaatgc aggcgggtaa acaccaagaa tatgaacaga 781 agctacttca agaattatat aaattaaatc ccaattttct tcagctatct acgggttcag 841 ttgataaaaa taagaacaaa gtgacaccac tgcagagccc cattgacaaa ccttcagatt 901 ctctcagtat agggaacggt gataattccc agcagatatc taacagtgat acgccttcac 961 caccacctgg tttgtcaaaa tccaatccag tcatccccat cagttcatcc aatcacagtg 1021 cacggtcccc ttttgaaggg gcagtaacag agtcacagtc gttattctca gacatttttc 1081 gccatcccaa ccctatccca agtgggcttc ctcctttccc cagctcccca cagacatcca 1141 gtgactggcc tacagcacca gaaccacaga gcctcttcac atcagaaaca atcccagtat 1201 catcctctac agactggcaa gcagcttttg gctttggttc ttctaaacaa ccagaggatg 1261 acttgggttt tgatcccttc gatgtcactc gaaaagcctt agcagacctg attgagaagg 1321 aactgtccgt tcaagaccaa ccttcccttt cgcccacatc tcttcagaac tcctcttcac 1381 acactacaac cgccaaaggt ccaggctctg gattccTGCA TCCTGCTGCA GCTACAAATG 1441 CCAATTCTCT CAATAGTACC TTTTCAGTCT TGCCCCAGAG GTTCCCTCAA TTTCAGCAGC 1501 ACCGAGCGGT TTATAATTCA TTCAGTTTTC CAGGCCAGGC AGCCCGCTAT CCTTGGATGG 1561 CCTTTCCACG CAATAGCATC ATGCACTTGA ACCACACAGC AAACCCCACC TCAAATAGTA 1621 ATTTCTTGGA CTTGAATCTC CCGCCACAGC ACAACACAGG TCTGGGAGGG ATCCCTGTAG 1681 CAGGGGAAGA AGAGGTGAAG GTTTCGACCA TGCCACTGTC AACCTCTTCC CATTCATTAC 1741 AACAAGGACA GCAGCCTACA AGTCTCCACA CTACTGTGGC CTGCCCAACT TTCTTGTACA 1801 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1861 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1921 AGGACGAGTG AGGCCTCGTT TGACCTCTCA AACGCGTTAA GTCgacaatc aacctctgga 1981 ttacaaaatt tgtgaaagat t