Transcript: Human NM_001190980.2

Homo sapiens YY1 associated factor 2 (YAF2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
YAF2 (10138)
Length:
5114
CDS:
189..542

Additional Resources:

NCBI RefSeq record:
NM_001190980.2
NBCI Gene record:
YAF2 (10138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095208 CAAGTGCATGATGTGCGATGT pLKO.1 299 CDS 100% 4.050 3.240 N Yaf2 n/a
2 TRCN0000332306 CAAGTGCATGATGTGCGATGT pLKO_005 299 CDS 100% 4.050 3.240 N Yaf2 n/a
3 TRCN0000108028 CGAGGCCTTCAAGTGCATGAT pLKO.1 290 CDS 100% 4.950 3.465 N YAF2 n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2407 3UTR 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2407 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07561 pDONR223 100% 45.2% 28% None (many diffs) n/a
2 ccsbBroad304_07561 pLX_304 0% 45.2% 28% V5 (many diffs) n/a
3 TRCN0000470372 CGGTATTACTATGAGTGCGCAACC pLX_317 77.3% 45.2% 28% V5 (many diffs) n/a
Download CSV