Transcript: Human NM_001193421.1

Homo sapiens teashirt zinc finger homeobox 2 (TSHZ2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
TSHZ2 (128553)
Length:
11671
CDS:
364..3459

Additional Resources:

NCBI RefSeq record:
NM_001193421.1
NBCI Gene record:
TSHZ2 (128553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016667 CGTATGCAAATCTCTAAGTTT pLKO.1 2998 CDS 100% 5.625 7.875 N TSHZ2 n/a
2 TRCN0000416683 GTACTGCAGATCCGGCCTAAT pLKO_005 2044 CDS 100% 10.800 8.640 N TSHZ2 n/a
3 TRCN0000016666 CCAAGATTTGAGCGTCCACAT pLKO.1 1215 CDS 100% 4.050 3.240 N TSHZ2 n/a
4 TRCN0000419443 CAGACATCAGAGGGCAAATAC pLKO_005 2950 CDS 100% 13.200 9.240 N TSHZ2 n/a
5 TRCN0000016664 CGGCAGCAACAAGAGTGATTT pLKO.1 831 CDS 100% 13.200 9.240 N TSHZ2 n/a
6 TRCN0000016665 GCCCAAGTTCAAGCACAATTT pLKO.1 2513 CDS 100% 13.200 9.240 N TSHZ2 n/a
7 TRCN0000421873 ACCATCCTGCTTCTGACATTG pLKO_005 3531 3UTR 100% 10.800 7.560 N TSHZ2 n/a
8 TRCN0000016663 CGGACATTTGTGAGCAAACAT pLKO.1 3355 CDS 100% 5.625 3.938 N TSHZ2 n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 10385 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 10385 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 10385 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 206 5UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.