Transcript: Human NM_001193544.2

Homo sapiens annexin A6 (ANXA6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
ANXA6 (309)
Length:
2898
CDS:
231..2156

Additional Resources:

NCBI RefSeq record:
NM_001193544.2
NBCI Gene record:
ANXA6 (309)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380966 AGTTGGACATGCTCGACATTC pLKO_005 982 CDS 100% 10.800 15.120 N ANXA6 n/a
2 TRCN0000380356 CGAAGACACAATCATCGATAT pLKO_005 1280 CDS 100% 10.800 15.120 N ANXA6 n/a
3 TRCN0000381506 GGTTGGTGTTCGATGAGTATC pLKO_005 769 CDS 100% 10.800 15.120 N ANXA6 n/a
4 TRCN0000008686 CGGTTGGTGTTCGATGAGTAT pLKO.1 768 CDS 100% 4.950 6.930 N ANXA6 n/a
5 TRCN0000008687 GCCTATCAGATGTGGGAACTT pLKO.1 1149 CDS 100% 4.950 6.930 N ANXA6 n/a
6 TRCN0000011462 CGACAAACTTTACAAATCCAT pLKO.1 1949 CDS 100% 3.000 4.200 N ANXA6 n/a
7 TRCN0000381229 AGGACCTCATTGCTGATTTAA pLKO_005 337 CDS 100% 15.000 10.500 N ANXA6 n/a
8 TRCN0000011461 CGGGCACTTCTGCCAAGAAAT pLKO.1 2171 3UTR 100% 13.200 9.240 N ANXA6 n/a
9 TRCN0000381717 GGCCATCAATGAGGCCTATAA pLKO_005 1547 CDS 100% 13.200 9.240 N ANXA6 n/a
10 TRCN0000381630 GGTGGTGGGAAGGATAGTAAA pLKO_005 2564 3UTR 100% 13.200 9.240 N ANXA6 n/a
11 TRCN0000381902 GCAAGTTTGAACGGTTGATTG pLKO_005 373 CDS 100% 10.800 7.560 N ANXA6 n/a
12 TRCN0000008688 CCTGCCTATTGTGATGCCAAA pLKO.1 411 CDS 100% 4.050 2.835 N ANXA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00071 pDONR223 100% 95.2% 95.2% None 0_1ins96 n/a
2 ccsbBroad304_00071 pLX_304 0% 95.2% 95.2% V5 0_1ins96 n/a
3 TRCN0000479967 AAAGAGGCTTCGGTGCACCTTGCG pLX_317 17.4% 95.2% 95.2% V5 0_1ins96 n/a
Download CSV