Transcript: Human NM_001195626.3

Homo sapiens MLLT10 histone lysine methyltransferase DOT1L cofactor (MLLT10), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MLLT10 (8028)
Length:
5143
CDS:
290..3496

Additional Resources:

NCBI RefSeq record:
NM_001195626.3
NBCI Gene record:
MLLT10 (8028)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234825 GGTAACCAACTGGCAATTAAT pLKO_005 2999 CDS 100% 15.000 21.000 N MLLT10 n/a
2 TRCN0000234822 GTTCCGCATGATCGTTATAAT pLKO_005 671 CDS 100% 15.000 21.000 N MLLT10 n/a
3 TRCN0000234823 GCACTAGCAACAACTCTATAT pLKO_005 1095 CDS 100% 13.200 18.480 N MLLT10 n/a
4 TRCN0000013135 CCTCAGGACTAGGATTACTTT pLKO.1 3150 CDS 100% 5.625 4.500 N MLLT10 n/a
5 TRCN0000234826 TGTTAAGACCTACTCATATTT pLKO_005 4150 3UTR 100% 15.000 10.500 N MLLT10 n/a
6 TRCN0000234824 AGATACTACTGCACGATTTAC pLKO_005 1138 CDS 100% 13.200 9.240 N MLLT10 n/a
7 TRCN0000013134 CCCAGGATTTCCTGAGCTTTA pLKO.1 1401 CDS 100% 10.800 7.560 N MLLT10 n/a
8 TRCN0000013136 CCATGTAACATGCGCTCAGTT pLKO.1 787 CDS 100% 4.950 3.465 N MLLT10 n/a
9 TRCN0000013133 CCTGCTGTTCTAGCACTTCAT pLKO.1 3526 3UTR 100% 4.950 3.465 N MLLT10 n/a
10 TRCN0000013137 CCCTCATATAGGAAACAGCTT pLKO.1 2731 CDS 100% 2.640 1.848 N MLLT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01854 pDONR223 100% 10% 8.4% None (many diffs) n/a
2 ccsbBroad304_01854 pLX_304 0% 10% 8.4% V5 (many diffs) n/a
3 TRCN0000465549 CCCTTAACTCAAGAATGGTATGTG pLX_317 76.6% 10% 8.4% V5 (many diffs) n/a
Download CSV