Transcript: Human NM_001195677.2

Homo sapiens VAMP associated protein B and C (VAPB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
VAPB (9217)
Length:
7467
CDS:
232..531

Additional Resources:

NCBI RefSeq record:
NM_001195677.2
NBCI Gene record:
VAPB (9217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381294 TGTTGTCACCACCAACCTAAA pLKO_005 303 CDS 100% 10.800 8.640 N VAPB n/a
2 TRCN0000152239 CCAGTTCTGTTTGACTATGTA pLKO.1 1854 3UTR 100% 5.625 3.938 N VAPB n/a
3 TRCN0000292369 CCAGTTCTGTTTGACTATGTA pLKO_005 1854 3UTR 100% 5.625 3.938 N VAPB n/a
4 TRCN0000152520 GACAGACCGAAATGTGTGTTT pLKO.1 336 CDS 100% 4.950 3.465 N VAPB n/a
5 TRCN0000292368 GACAGACCGAAATGTGTGTTT pLKO_005 336 CDS 100% 4.950 3.465 N VAPB n/a
6 TRCN0000156377 CCTTGGTACATGATGCTGGAT pLKO.1 911 3UTR 100% 2.640 1.848 N VAPB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02110 pDONR223 100% 41.5% 31.5% None 210_211ins362;297_298ins55 n/a
2 ccsbBroad304_02110 pLX_304 0% 41.5% 31.5% V5 210_211ins362;297_298ins55 n/a
3 TRCN0000465325 TTTCGGCACTACCTGGTCAGCATA pLX_317 51.1% 41.5% 31.5% V5 210_211ins362;297_298ins55 n/a
Download CSV