Construct: ORF TRCN0000465325
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007586.1_s317c1
- Derived from:
- ccsbBroadEn_02110
- DNA Barcode:
- TTTCGGCACTACCTGGTCAGCATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VAPB (9217)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465325
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9217 | VAPB | VAMP associated protein B a... | NM_004738.5 | 97.9% | 97.9% | 715_729del |
| 2 | human | 9217 | VAPB | VAMP associated protein B a... | XR_001754433.2 | 42.8% | 1_249del;646_808del;895_896ins231 | |
| 3 | human | 9217 | VAPB | VAMP associated protein B a... | NM_001195677.2 | 41.5% | 31.5% | 210_211ins362;297_298ins55 |
| 4 | human | 9217 | VAPB | VAMP associated protein B a... | NR_036633.2 | 6.7% | 1_231del;442_443ins185;761_7644del | |
| 5 | mouse | 56491 | Vapb | vesicle-associated membrane... | NM_019806.5 | 85.4% | 88% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 780
- ORF length:
- 714
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaaggtggag caggtcctga gcctcgagcc gcagcacgag ctcaaattcc 121 gaggtccctt caccgatgtt gtcaccacca acctaaagct tggcaacccg acagaccgaa 181 atgtgtgttt taaggtgaag actacagcac cacgtaggta ctgtgtgagg cccaacagcg 241 gaatcatcga tgcaggggcc tcaattaatg tatctgtgat gttacagcct ttcgattatg 301 atcccaatga gaaaagtaaa cacaagttta tggttcagtc tatgtttgct ccaactgaca 361 cttcagatat ggaagcagta tggaaggagg caaaaccgga agaccttatg gattcaaaac 421 ttAGATGTGT GTTTGAATTG CCAGCAGAGA ATGATAAACC ACATGATGTA GAAATAAATA 481 AAATTATATC CACAACTGCA TCAAAGACAG AAACACCAAT AGTGTCTAAG TCTCTGAGTT 541 CTTCTTTGGA TGACACCGAA GTTAAGAAGG TTATGGAAGA ATGTAAGAGG CTGCAAGGTG 601 AAGTTCAGAG GCTACGGGAG GAGAACAAGC AGTTCAAGGA AGAAGATGGA CTGCGGATGA 661 GGAAGACAGT GCAGAGCAAC AGCCCCATTT CAGCATTAGC CCCAACTGGG AAGGAAGAAG 721 GCCTTAGCAC CCGGCTCTTG GCTCTGGTGG TTTTGTTCTT TATCGTTGGT GTAATTATTG 781 GGAAGATTGC CTTGTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 841 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 901 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TTTCGGCACT ACCTGGTCAG 961 CATAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt