Transcript: Human NM_001197114.1

Homo sapiens IQCJ-SCHIP1 readthrough (IQCJ-SCHIP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
IQCJ-SCHIP1 (100505385)
Length:
2384
CDS:
182..1792

Additional Resources:

NCBI RefSeq record:
NM_001197114.1
NBCI Gene record:
IQCJ-SCHIP1 (100505385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001197114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422545 GATGATGGCCCAGGAATTTAT pLKO_005 1145 CDS 100% 15.000 7.500 Y SCHIP1 n/a
2 TRCN0000255721 ATCCTCTAGAACAAGTTAATG pLKO_005 213 CDS 100% 13.200 6.600 Y IQCJ n/a
3 TRCN0000106560 CCAGAGAACAAGCTAGAATTT pLKO.1 1808 3UTR 100% 13.200 6.600 Y Schip1 n/a
4 TRCN0000327417 CCAGAGAACAAGCTAGAATTT pLKO_005 1808 3UTR 100% 13.200 6.600 Y Schip1 n/a
5 TRCN0000107055 GCCACTTAATATCAGGCATTT pLKO.1 1969 3UTR 100% 10.800 5.400 Y SCHIP1 n/a
6 TRCN0000437353 TGCTAAAGGTGGCGCAGAAAC pLKO_005 1859 3UTR 100% 10.800 5.400 Y SCHIP1 n/a
7 TRCN0000107059 CACATGCCTCATATAAGTGAA pLKO.1 1529 CDS 100% 4.950 2.475 Y SCHIP1 n/a
8 TRCN0000107058 GCAGCTACAAGTGATAGTCAA pLKO.1 1603 CDS 100% 4.950 2.475 Y SCHIP1 n/a
9 TRCN0000107056 GCCTCATATAAGTGAATGCTT pLKO.1 1534 CDS 100% 3.000 1.500 Y SCHIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001197114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08154 pDONR223 100% 44.6% 43.8% None (many diffs) n/a
2 ccsbBroad304_08154 pLX_304 0% 44.6% 43.8% V5 (many diffs) n/a
3 TRCN0000472729 TACGAATTGCCGAAGCTCGATTAC pLX_317 56.6% 44.6% 43.8% V5 (many diffs) n/a
Download CSV