Transcript: Human NM_001197319.3

Homo sapiens C-type lectin domain family 2 member D (CLEC2D), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CLEC2D (29121)
Length:
5062
CDS:
23..310

Additional Resources:

NCBI RefSeq record:
NM_001197319.3
NBCI Gene record:
CLEC2D (29121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001197319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371853 GTGCACAGGAACTCCTATTTA pLKO_005 735 3UTR 100% 15.000 10.500 N CLEC2D n/a
2 TRCN0000060410 CCCAGAAAGCTGGATTGGTTT pLKO.1 136 CDS 100% 4.950 3.465 N CLEC2D n/a
3 TRCN0000060411 GCCATCAAGAGCCATCAGTAT pLKO.1 99 CDS 100% 4.950 3.465 N CLEC2D n/a
4 TRCN0000060412 TGTGCCTATTTGAATGACAAA pLKO.1 294 CDS 100% 4.950 3.465 N CLEC2D n/a
5 TRCN0000060408 CCAACTAATCTTTAGAAGCAT pLKO.1 400 3UTR 100% 3.000 2.100 N CLEC2D n/a
6 TRCN0000298629 GTTCAGGGCCAGTGCATATTA pLKO_005 1205 3UTR 100% 15.000 7.500 Y NPM1 n/a
7 TRCN0000062270 GCGCCAGTGAAGAAATCTATA pLKO.1 1423 3UTR 100% 13.200 6.600 Y NPM1 n/a
8 TRCN0000286483 GCGCCAGTGAAGAAATCTATA pLKO_005 1423 3UTR 100% 13.200 6.600 Y NPM1 n/a
9 TRCN0000062268 GCCAAGAATGTGTTGTCCAAA pLKO.1 1878 3UTR 100% 4.950 2.475 Y NPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001197319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11901 pDONR223 100% 59.4% 55.1% None (many diffs) n/a
2 ccsbBroad304_11901 pLX_304 0% 59.4% 55.1% V5 (many diffs) n/a
3 TRCN0000465819 ACTCATCGTGCATCACCAGACCCT pLX_317 89.6% 59.4% 55.1% V5 (many diffs) n/a
Download CSV