Transcript: Human NM_001198.4

Homo sapiens PR/SET domain 1 (PRDM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PRDM1 (639)
Length:
5148
CDS:
219..2696

Additional Resources:

NCBI RefSeq record:
NM_001198.4
NBCI Gene record:
PRDM1 (639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013611 CCCTACGGCATGAATTGTAAT pLKO.1 1467 CDS 100% 13.200 18.480 N PRDM1 n/a
2 TRCN0000013608 GCCCACAATCAACAGTGGTTT pLKO.1 4968 3UTR 100% 4.950 6.930 N PRDM1 n/a
3 TRCN0000013609 CGGGATGAACATCTACTTCTA pLKO.1 752 CDS 100% 4.950 3.960 N PRDM1 n/a
4 TRCN0000218813 ACGAAGCCATGAATCTCATTA pLKO_005 1849 CDS 100% 13.200 9.240 N PRDM1 n/a
5 TRCN0000235671 CATCTACTTCTACACCATTAA pLKO_005 761 CDS 100% 13.200 9.240 N PRDM1 n/a
6 TRCN0000235668 CCAACAGTGAAGAGGTTATTG pLKO_005 496 CDS 100% 13.200 9.240 N PRDM1 n/a
7 TRCN0000235669 CCACTTCATTGACGGCTTTAA pLKO_005 653 CDS 100% 13.200 9.240 N PRDM1 n/a
8 TRCN0000013610 CGAAGCCATGAATCTCATTAA pLKO.1 1850 CDS 100% 13.200 9.240 N PRDM1 n/a
9 TRCN0000235670 TCCCATTACTAAGACTATTAC pLKO_005 3003 3UTR 100% 13.200 9.240 N PRDM1 n/a
10 TRCN0000013612 GCCTGAAAGTGTCTTTGCAAA pLKO.1 2530 CDS 100% 4.950 3.465 N PRDM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00163 pDONR223 100% 83.6% 83.3% None (many diffs) n/a
2 ccsbBroad304_00163 pLX_304 32.4% 83.6% 83.3% V5 (many diffs) n/a
3 TRCN0000492300 CGTCGGGTCCTCGACTCTACATTA pLX_317 10.7% 83.6% 83.3% V5 (many diffs) n/a
Download CSV