Transcript: Human NM_001198764.1

Homo sapiens CD302 molecule (CD302), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-03
Taxon:
Homo sapiens (human)
Gene:
CD302 (9936)
Length:
3884
CDS:
58..645

Additional Resources:

NCBI RefSeq record:
NM_001198764.1
NBCI Gene record:
CD302 (9936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296808 TGATTGCTAGCACGGTAATTT pLKO_005 470 CDS 100% 15.000 7.500 Y CD302 n/a
2 TRCN0000296880 TTCCTTATTCCAGTAACATTT pLKO_005 753 3UTR 100% 13.200 6.600 Y CD302 n/a
3 TRCN0000061153 CGGACATGATAAGCATACATA pLKO.1 128 CDS 100% 5.625 2.813 Y CD302 n/a
4 TRCN0000291199 CGGACATGATAAGCATACATA pLKO_005 128 CDS 100% 5.625 2.813 Y CD302 n/a
5 TRCN0000061154 GATGCGAGTTTCAAGTGGTTT pLKO.1 241 CDS 100% 4.950 2.475 Y CD302 n/a
6 TRCN0000061157 AGCAATCATTTGGTTCCTGTA pLKO.1 504 CDS 100% 4.050 2.025 Y CD302 n/a
7 TRCN0000061155 CTGCACATCAAGACAGGTGAA pLKO.1 337 CDS 100% 4.050 2.025 Y CD302 n/a
8 TRCN0000307632 CTGCACATCAAGACAGGTGAA pLKO_005 337 CDS 100% 4.050 2.025 Y CD302 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3093 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3093 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11433 pDONR223 100% 87.1% 87.1% None 1_75del n/a
2 ccsbBroad304_11433 pLX_304 0% 87.1% 87.1% V5 1_75del n/a
3 TRCN0000475153 TCTCTACAACCATGATTTCAAAAG pLX_317 73.9% 87.1% 87.1% V5 1_75del n/a
Download CSV