Transcript: Human NM_001198807.1

Homo sapiens Myb/SANT DNA binding domain containing 3 (MSANTD3), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
MSANTD3 (91283)
Length:
1895
CDS:
215..694

Additional Resources:

NCBI RefSeq record:
NM_001198807.1
NBCI Gene record:
MSANTD3 (91283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426855 AGAGTGGTAGTAGTCACTTAT pLKO_005 1217 3UTR 100% 13.200 9.240 N Msantd3 n/a
2 TRCN0000158262 CCTCTCAGGAAGGTGCTTTAA pLKO.1 843 3UTR 100% 13.200 9.240 N MSANTD3 n/a
3 TRCN0000153420 GAATGGCCTGTTTCCTCATTT pLKO.1 1064 3UTR 100% 13.200 9.240 N MSANTD3 n/a
4 TRCN0000150829 GAGTGGTAGTAGTCACTTATT pLKO.1 1218 3UTR 100% 13.200 9.240 N MSANTD3 n/a
5 TRCN0000153773 CATGAGGAAGAACACCATCAA pLKO.1 872 3UTR 100% 4.950 3.465 N MSANTD3 n/a
6 TRCN0000152029 CGATGATGAGAAAGAGTTCAT pLKO.1 733 3UTR 100% 4.950 3.465 N MSANTD3 n/a
7 TRCN0000153389 GAATGTCTGGAACATGGACTT pLKO.1 1155 3UTR 100% 4.050 2.835 N MSANTD3 n/a
8 TRCN0000152676 GTTGGCAAAGAATGTCTGGAA pLKO.1 1146 3UTR 100% 2.640 1.848 N MSANTD3 n/a
9 TRCN0000153103 GCTGTCAGAATAACAGCCAAT pLKO.1 803 3UTR 100% 0.405 0.284 N MSANTD3 n/a
10 TRCN0000152882 GAGGAAGAACACCATCAACAA pLKO.1 875 3UTR 100% 4.950 2.970 N MSANTD3 n/a
11 TRCN0000156916 GAAGAAGTGCTGGGAGAACAT pLKO.1 424 CDS 100% 4.950 2.475 Y MSANTD3 n/a
12 TRCN0000157199 GCCCATGAAAGGAGAGAGAAA pLKO.1 470 CDS 100% 4.950 2.475 Y MSANTD3 n/a
13 TRCN0000177770 CTCAGGAAGGTGCTTTAAAGA pLKO.1 846 3UTR 100% 5.625 3.938 N Msantd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467618 ATGTCAATGGGCTATTTGCCCCGG pLX_317 25.5% 54.6% 53% V5 (not translated due to frame shift) (many diffs) n/a
2 ccsbBroadEn_09312 pDONR223 100% 54.5% 53% None (many diffs) n/a
3 ccsbBroad304_09312 pLX_304 0% 54.5% 53% V5 (many diffs) n/a
Download CSV