Transcript: Human NM_001198829.2

Homo sapiens lipase F, gastric type (LIPF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
LIPF (8513)
Length:
1472
CDS:
113..1339

Additional Resources:

NCBI RefSeq record:
NM_001198829.2
NBCI Gene record:
LIPF (8513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051138 CCAGCCACAATCGACTTCATT pLKO.1 593 CDS 100% 5.625 4.500 N LIPF n/a
2 TRCN0000051141 CCAGAAGAAACTTGTACTATT pLKO.1 513 CDS 100% 13.200 9.240 N LIPF n/a
3 TRCN0000436939 CCATTGGACCCAGGCTGTTAA pLKO_005 1018 CDS 100% 13.200 9.240 N LIPF n/a
4 TRCN0000051139 CCTGAAGTGACTATGAACATT pLKO.1 227 CDS 100% 5.625 3.938 N LIPF n/a
5 TRCN0000051142 CCACACAACTTCTTTGATCAA pLKO.1 839 CDS 100% 4.950 3.465 N LIPF n/a
6 TRCN0000178813 CAGCTTTGATGAAATGGCTAA pLKO.1 562 CDS 100% 4.050 2.835 N Lipf n/a
7 TRCN0000051140 TGGATGTGTATCTATCACATA pLKO.1 966 CDS 100% 0.495 0.347 N LIPF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07250 pDONR223 100% 97.3% 97.3% None 1_30del;511A>G;996A>G n/a
2 ccsbBroad304_07250 pLX_304 0% 97.3% 97.3% V5 1_30del;511A>G;996A>G n/a
3 TRCN0000465321 ACTGATACGCAAATTACATGTGGA pLX_317 23% 97.3% 97.3% V5 1_30del;511A>G;996A>G n/a
Download CSV