Transcript: Human NM_001198845.1

Homo sapiens RBM14-RBM4 readthrough (RBM14-RBM4), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
RBM14-RBM4 (100526737)
Length:
1614
CDS:
140..1159

Additional Resources:

NCBI RefSeq record:
NM_001198845.1
NBCI Gene record:
RBM14-RBM4 (100526737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338597 GCAGACTTGACCGAGCAATAT pLKO_005 614 CDS 100% 13.200 6.600 Y RBM4 n/a
2 TRCN0000338596 TGCAGCTGCCTCCGTGTATAA pLKO_005 772 CDS 100% 13.200 6.600 Y RBM4 n/a
3 TRCN0000160719 CCTGTTCTTCTGTCCTTCAAT pLKO.1 1354 3UTR 100% 5.625 2.813 Y RBM4 n/a
4 TRCN0000338541 CCTGTTCTTCTGTCCTTCAAT pLKO_005 1354 3UTR 100% 5.625 2.813 Y RBM4 n/a
5 TRCN0000103961 CCGAGCAATATAATGAGCAAT pLKO.1 624 CDS 100% 4.950 2.475 Y Rbm4 n/a
6 TRCN0000159632 GACCTTAATTTACCTTGCTAA pLKO.1 1285 3UTR 100% 4.950 2.475 Y RBM4 n/a
7 TRCN0000072694 GCCTCTTAATACTTGGAAGAT pLKO.1 361 CDS 100% 4.950 2.475 Y RBM14 n/a
8 TRCN0000103963 ACCGAGCAATATAATGAGCAA pLKO.1 623 CDS 100% 2.640 1.320 Y Rbm4 n/a
9 TRCN0000162417 CGTGTATAATTACGCAGAGCA pLKO.1 784 CDS 100% 2.640 1.320 Y RBM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01382 pDONR223 100% 77.2% 74.5% None (many diffs) n/a
2 ccsbBroad304_01382 pLX_304 0% 77.2% 74.5% V5 (many diffs) n/a
3 TRCN0000467520 CATTGTCTACCGGTTTAACTCAAT pLX_317 39.8% 77.2% 74.5% V5 (many diffs) n/a
Download CSV