Construct: ORF TRCN0000467520
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001937.1_s317c1
- Derived from:
- ccsbBroadEn_01382
- DNA Barcode:
- CATTGTCTACCGGTTTAACTCAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBM4 (5936)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467520
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5936 | RBM4 | RNA binding motif protein 4 | NM_002896.3 | 100% | 100% | |
| 2 | human | 83759 | RBM4B | RNA binding motif protein 4B | NM_031492.4 | 85.7% | 89.3% | (many diffs) |
| 3 | human | 83759 | RBM4B | RNA binding motif protein 4B | XM_011545297.3 | 85.7% | 89.3% | (many diffs) |
| 4 | human | 83759 | RBM4B | RNA binding motif protein 4B | XM_017018402.2 | 85.7% | 89.3% | (many diffs) |
| 5 | human | 100526737 | RBM14-RBM4 | RBM14-RBM4 readthrough | NM_001198845.1 | 77.2% | 74.5% | (many diffs) |
| 6 | human | 83759 | RBM4B | RNA binding motif protein 4B | XR_247214.3 | 46.2% | (many diffs) | |
| 7 | human | 83759 | RBM4B | RNA binding motif protein 4B | XR_247213.3 | 44.4% | (many diffs) | |
| 8 | human | 5936 | RBM4 | RNA binding motif protein 4 | NM_001198844.2 | 44.3% | 38.6% | (many diffs) |
| 9 | human | 5936 | RBM4 | RNA binding motif protein 4 | NM_001198843.1 | 38.8% | 38.4% | (many diffs) |
| 10 | human | 83759 | RBM4B | RNA binding motif protein 4B | NM_001286135.2 | 37.5% | 37.3% | (many diffs) |
| 11 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290122.1 | 92.8% | 95.8% | (many diffs) |
| 12 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290123.1 | 92.8% | 95.8% | (many diffs) |
| 13 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_009032.3 | 92.8% | 95.8% | (many diffs) |
| 14 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | NM_025717.3 | 82.6% | 87.6% | (many diffs) |
| 15 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531823.3 | 82.6% | 87.6% | (many diffs) |
| 16 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531824.3 | 82.6% | 87.6% | (many diffs) |
| 17 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531825.3 | 82.6% | 87.6% | (many diffs) |
| 18 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531826.2 | 82.6% | 87.6% | (many diffs) |
| 19 | mouse | 102902673 | Gm21992 | predicted gene 21992 | NM_001290128.1 | 72.9% | 71.1% | (many diffs) |
| 20 | mouse | 102902673 | Gm21992 | predicted gene 21992 | NM_001290127.1 | 70.4% | 72.7% | (many diffs) |
| 21 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531827.3 | 38.2% | 37.9% | (many diffs) |
| 22 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290124.1 | 35.9% | 37.9% | (many diffs) |
| 23 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290125.1 | 35.9% | 37.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1158
- ORF length:
- 1092
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gaagctgttc atcggaaacc tgccccggga ggctacagag caggagattc 121 gctcactctt cgagcagtat gggaaggtgc tggaatgtga catcattaag aattacggct 181 ttgtgcacat agaagacaag acggcagctg aggatgccat acgcaacctg caccattaca 241 agcttcatgg ggtgaacatc aacgtggaag ccagcaagaa taagagcaaa acctcaacaa 301 agttgcatgt gggcaacatc agtcccacct gcaccaataa ggagcttcga gccaagtttg 361 aggagtatgg tccggtcatc gaatgtgaca tcgtgaaaga ttatgccttc gtacacatgg 421 agcgggcaga ggatgcagtg gaggccatca ggggccttga taacacagag tttcaaggca 481 aacgaatgca cgtgcagttg tccaccagcc ggcttaggac tgcgcccggg atgggagacc 541 agagcggctg ctatcggtgc gggaaagagg ggcactggtc caaagagtgt ccgatagatc 601 gttcaggccg cgtggcagac ttgaccgagc aatataatga gcaatacgga gcagtgcgta 661 cgccttacac catgagctat ggggattcat tgtattacaa caacgcgtac ggagcgctcg 721 atgccTACTA CAAGCGCTGC CGTGCTGCCC GGTCCTATGA GGCAGTGGCA GCTGCAGCTG 781 CCTCCGTGTA TAATTACGCA GAGCAGACCC TGTCCCAGCT GCCACAAGTC CAGAATACAG 841 CCATGGCCAG TCACCTCACC TCCACCTCTC TCGATCCCTA CGATAGACAC CTGTTGCCGA 901 CCTCAGGAGC TGCTGCCACA GCTGCTGCTG CAGCAGCAGC CGCTGCTGCT GTTACTGCAG 961 CTTCCACTTC ATATTACGGG CGGGATCGGA GCCCCCTGCG TCGCGCTACA GCCCCAGTCC 1021 CCACTGTTGG AGAGGGCTAC GGTTACGGGC ATGAGAGTGA GTTGTCCCAA GCTTCAGCAG 1081 CCGCGCGGAA TTCTCTGTAC GACATGGCCC GGTATGAGCG GGAGCAGTAT GCCGATCGGG 1141 CGCGGTACTC AGCCTTTTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1201 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1261 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACATTGTC TACCGGTTTA 1321 ACTCAATACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt