Transcript: Mouse NM_001198949.1

Mus musculus ralA binding protein 1 (Ralbp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ralbp1 (19765)
Length:
3788
CDS:
302..2248

Additional Resources:

NCBI RefSeq record:
NM_001198949.1
NBCI Gene record:
Ralbp1 (19765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106249 CCGAGCTGAAATTGCGGAGAT pLKO.1 1852 CDS 100% 4.050 5.670 N Ralbp1 n/a
2 TRCN0000305689 CAGATAGTGTCAGCTTATTTG pLKO_005 2434 3UTR 100% 13.200 9.240 N Ralbp1 n/a
3 TRCN0000305635 ACAGGAGATAGCTAGTCTTTC pLKO_005 1669 CDS 100% 10.800 7.560 N Ralbp1 n/a
4 TRCN0000047918 CCAGAGAATTTGCTTACCAAA pLKO.1 1124 CDS 100% 4.950 3.465 N RALBP1 n/a
5 TRCN0000291519 CCAGAGAATTTGCTTACCAAA pLKO_005 1124 CDS 100% 4.950 3.465 N RALBP1 n/a
6 TRCN0000106248 CCTCCTGATACAGTGTCAGAT pLKO.1 470 CDS 100% 4.950 3.465 N Ralbp1 n/a
7 TRCN0000323936 CCTCCTGATACAGTGTCAGAT pLKO_005 470 CDS 100% 4.950 3.465 N Ralbp1 n/a
8 TRCN0000106246 GCGGGATAAAGGACTTATCTA pLKO.1 1554 CDS 100% 0.563 0.394 N Ralbp1 n/a
9 TRCN0000305636 CAGCTTGCTGAAGCAGTATTT pLKO_005 1093 CDS 100% 13.200 7.920 N Ralbp1 n/a
10 TRCN0000106247 GTCTCCAAACTTAGAAGAATA pLKO.1 1054 CDS 100% 13.200 7.920 N Ralbp1 n/a
11 TRCN0000323937 GTCTCCAAACTTAGAAGAATA pLKO_005 1054 CDS 100% 13.200 7.920 N Ralbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02565 pDONR223 100% 87.5% 91.7% None (many diffs) n/a
2 ccsbBroad304_02565 pLX_304 0% 87.5% 91.7% V5 (many diffs) n/a
3 TRCN0000476105 GGGCCTCACCTTAGTTTAGCCCCG pLX_317 18% 87.5% 91.7% V5 (many diffs) n/a
Download CSV