Transcript: Human NM_001199.4

Homo sapiens bone morphogenetic protein 1 (BMP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
BMP1 (649)
Length:
2506
CDS:
35..2227

Additional Resources:

NCBI RefSeq record:
NM_001199.4
NBCI Gene record:
BMP1 (649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003501 GCTCGTAAGTCCTCCATCAAA pLKO.1 269 CDS 100% 5.625 7.875 N BMP1 n/a
2 TRCN0000003498 GTCCATTAACAAAGCGGGCTT pLKO.1 1633 CDS 100% 2.160 3.024 N BMP1 n/a
3 TRCN0000371423 ACTGACGAGGACAGCTATATT pLKO_005 542 CDS 100% 15.000 12.000 N BMP1 n/a
4 TRCN0000371424 ACAGCTGTGCCTACGACTATC pLKO_005 1491 CDS 100% 10.800 7.560 N BMP1 n/a
5 TRCN0000421608 TTCGACAGCATCATGCATTAC pLKO_005 830 CDS 100% 10.800 7.560 N BMP1 n/a
6 TRCN0000003497 CACCTCCCAGTACAACAACAT pLKO.1 2056 CDS 100% 4.950 3.465 N BMP1 n/a
7 TRCN0000003499 GCGCTACTGTGGCTATGAGAA pLKO.1 1555 CDS 100% 4.950 3.465 N BMP1 n/a
8 TRCN0000371425 GAACCTCACCTTGGACGGAAT pLKO_005 2263 3UTR 100% 4.050 2.835 N BMP1 n/a
9 TRCN0000423614 GACAGAACTGGTGCTCTCTTC pLKO_005 2355 3UTR 100% 4.050 2.835 N BMP1 n/a
10 TRCN0000003500 CGCCCAACTACCCAGACGATT pLKO.1 1377 CDS 100% 1.650 1.155 N BMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05897 pDONR223 100% 72.8% 70.5% None (many diffs) n/a
2 ccsbBroad304_05897 pLX_304 0% 72.8% 70.5% V5 (many diffs) n/a
3 TRCN0000477087 GCGCGCCTTTGGAGAACAACTCGG pLX_317 13.6% 72.8% 70.5% V5 (many diffs) n/a
Download CSV