Transcript: Mouse NM_001199004.1

Mus musculus golgi autoantigen, golgin subfamily a, 5 (Golga5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Golga5 (27277)
Length:
2847
CDS:
261..2450

Additional Resources:

NCBI RefSeq record:
NM_001199004.1
NBCI Gene record:
Golga5 (27277)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247043 ACACGGATACTCCAATCTAAA pLKO_005 1560 CDS 100% 13.200 18.480 N Golga5 n/a
2 TRCN0000257725 CCGGACAGAAAGCTAACTATA pLKO_005 427 CDS 100% 13.200 18.480 N Golga5 n/a
3 TRCN0000247042 TAGCTCCATTGACCAATTTAG pLKO_005 2285 CDS 100% 13.200 18.480 N Golga5 n/a
4 TRCN0000247044 GAGTTCAGTTCCCTAGATATG pLKO_005 2667 3UTR 100% 10.800 8.640 N Golga5 n/a
5 TRCN0000247045 ACACTGCAAAGCAGGATTAAA pLKO_005 1917 CDS 100% 15.000 10.500 N Golga5 n/a
6 TRCN0000216663 CAACAGTGGATCTGCCATTAA pLKO.1 2153 CDS 100% 13.200 9.240 N Golga5 n/a
7 TRCN0000174624 GCAGACAGTAATTTGACAAAT pLKO.1 2629 3UTR 100% 13.200 9.240 N Golga5 n/a
8 TRCN0000233054 GAGTTTGCTGCACGCCTTAAT pLKO_005 1374 CDS 100% 13.200 18.480 N GOLGA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.