Transcript: Human NM_001199052.2

Homo sapiens LEM domain containing 1 (LEMD1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
LEMD1 (93273)
Length:
666
CDS:
106..309

Additional Resources:

NCBI RefSeq record:
NM_001199052.2
NBCI Gene record:
LEMD1 (93273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000451451 GTCGCTGTTTGGTTAAGTAAT pLKO_005 371 3UTR 100% 13.200 18.480 N LEMD1 n/a
2 TRCN0000148815 CCAGAATCACATATGGGACTA pLKO.1 211 CDS 100% 0.000 0.000 N LEMD1 n/a
3 TRCN0000149833 CCAACTTGAGAAGCTTGGATT pLKO.1 147 CDS 100% 4.950 3.465 N LEMD1 n/a
4 TRCN0000148273 CAGAATCACATATGGGACTAT pLKO.1 212 CDS 100% 0.000 0.000 N LEMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09356 pDONR223 100% 37% 21.8% None 82_83ins265;201_202ins77 n/a
2 ccsbBroad304_09356 pLX_304 0% 37% 21.8% V5 82_83ins265;201_202ins77 n/a
3 TRCN0000471726 ACAACCCAAATACTCTGAGTTATC pLX_317 83.1% 37% 21.8% V5 82_83ins265;201_202ins77 n/a
Download CSV