Transcript: Human NM_001199138.2

Homo sapiens NLR family CARD domain containing 4 (NLRC4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
NLRC4 (58484)
Length:
3362
CDS:
268..3342

Additional Resources:

NCBI RefSeq record:
NM_001199138.2
NBCI Gene record:
NLRC4 (58484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162759 CACAATCAGGAAGCAGACATT pLKO.1 942 CDS 100% 4.950 6.930 N NLRC4 n/a
2 TRCN0000163019 GCAGTTGAATTTGGCGGGAAA pLKO.1 3087 CDS 100% 4.050 5.670 N NLRC4 n/a
3 TRCN0000160000 CGGACATTACATCCACTTATA pLKO.1 1709 CDS 100% 13.200 10.560 N NLRC4 n/a
4 TRCN0000158998 GAACCTTACAAAGCTCATAAT pLKO.1 2556 CDS 100% 13.200 10.560 N NLRC4 n/a
5 TRCN0000162758 CAGAAATCGAAGCCCTGATAA pLKO.1 1043 CDS 100% 13.200 9.240 N NLRC4 n/a
6 TRCN0000159999 CAAAGGTTCAAGCCAAAGTAT pLKO.1 1564 CDS 100% 5.625 3.938 N NLRC4 n/a
7 TRCN0000160665 CGCGAAGAAGTAAACATCATT pLKO.1 370 CDS 100% 5.625 3.938 N NLRC4 n/a
8 TRCN0000162275 CGGGATTTCAGCAAGTTGAAT pLKO.1 2266 CDS 100% 5.625 3.938 N NLRC4 n/a
9 TRCN0000160076 CCATACCTTCTATGATCTGTT pLKO.1 1356 CDS 100% 4.950 3.465 N NLRC4 n/a
10 TRCN0000160604 CCCTTATTCAAAGAATGGGAA pLKO.1 296 CDS 100% 2.640 1.848 N NLRC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08776 pDONR223 100% 99.9% 99.9% None 22A>G;3069T>C n/a
2 ccsbBroad304_08776 pLX_304 0% 99.9% 99.9% V5 22A>G;3069T>C n/a
3 TRCN0000467727 CCCCTAATATCAATCCCCCCGCTC pLX_317 12.8% 99.9% 99.9% V5 22A>G;3069T>C n/a
Download CSV