Transcript: Human NM_001199219.2

Homo sapiens indolethylamine N-methyltransferase (INMT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
INMT (11185)
Length:
2556
CDS:
17..805

Additional Resources:

NCBI RefSeq record:
NM_001199219.2
NBCI Gene record:
INMT (11185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420750 AGAGTCTACCTAATATGTTAA pLKO_005 1098 3UTR 100% 13.200 18.480 N INMT n/a
2 TRCN0000425810 TGAGTCTACCTAATATGTTAA pLKO_005 1134 3UTR 100% 13.200 9.240 N INMT n/a
3 TRCN0000036118 GCTGTCCTGGATGCTGGCTTT pLKO.1 683 CDS 100% 1.350 0.945 N INMT n/a
4 TRCN0000036116 CAGAGCTACTCTGTCACCAAT pLKO.1 731 CDS 100% 4.950 2.970 N INMT n/a
5 TRCN0000426277 GGGACACGCTGATTGACATTG pLKO_005 180 CDS 100% 10.800 5.400 Y INMT n/a
6 TRCN0000036115 GACATCACTCTCTCCGACTTT pLKO.1 251 CDS 100% 4.950 2.475 Y INMT n/a
7 TRCN0000036117 TGCTGAAGTTTAACTTGGAAT pLKO.1 126 CDS 100% 4.950 2.475 Y INMT n/a
8 TRCN0000036114 GCTACTTACTACAGCTTCGAT pLKO.1 80 CDS 100% 3.000 1.500 Y INMT n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1617 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1617 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07765 pDONR223 100% 99.2% 98.4% None (many diffs) n/a
2 ccsbBroad304_07765 pLX_304 0% 99.2% 98.4% V5 (many diffs) n/a
3 TRCN0000478318 CACACACGCGCCATATTGATCTTT pLX_317 37.1% 99.2% 98.4% V5 (many diffs) n/a
Download CSV