Transcript: Mouse NM_001199284.1

Mus musculus solute carrier family 43, member 2 (Slc43a2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc43a2 (215113)
Length:
6952
CDS:
127..1833

Additional Resources:

NCBI RefSeq record:
NM_001199284.1
NBCI Gene record:
Slc43a2 (215113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217864 GCATGACGTTCACTTCGTTAA pLKO.1 605 CDS 100% 10.800 15.120 N Slc43a2 n/a
2 TRCN0000247345 GCATGACGTTCACTTCGTTAA pLKO_005 605 CDS 100% 10.800 15.120 N Slc43a2 n/a
3 TRCN0000184383 GCCCTCTATACCTCCATCTTT pLKO.1 1207 CDS 100% 5.625 7.875 N Slc43a2 n/a
4 TRCN0000247344 GAGTGGAGGGCAGACTATTTA pLKO_005 2487 3UTR 100% 15.000 12.000 N Slc43a2 n/a
5 TRCN0000247343 GCGACCTTCGGTCCACATTTA pLKO_005 644 CDS 100% 13.200 10.560 N Slc43a2 n/a
6 TRCN0000247346 TGTCACACAGCTGCGACTTAT pLKO_005 1122 CDS 100% 13.200 10.560 N Slc43a2 n/a
7 TRCN0000247342 TCCTGCTTGCTGATTGCATAT pLKO_005 511 CDS 100% 10.800 7.560 N Slc43a2 n/a
8 TRCN0000172462 CATGGACTACTCGGTGAAGAT pLKO.1 843 CDS 100% 4.950 3.465 N SLC43A2 n/a
9 TRCN0000184341 GCAGTTACCTTCCCAGGAATA pLKO.1 697 CDS 100% 10.800 6.480 N Slc43a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04792 pDONR223 100% 87.8% 91.3% None (many diffs) n/a
2 ccsbBroad304_04792 pLX_304 0% 87.8% 91.3% V5 (many diffs) n/a
3 TRCN0000468209 CCAGGAACTCCTCTGTCACCATTA pLX_317 22.8% 87.8% 91.3% V5 (many diffs) n/a
Download CSV