Transcript: Mouse NM_001199304.1

Mus musculus ataxin 1 (Atxn1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Atxn1 (20238)
Length:
10474
CDS:
784..3159

Additional Resources:

NCBI RefSeq record:
NM_001199304.1
NBCI Gene record:
Atxn1 (20238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240656 TGTGATGGTTCTGCCTAATAG pLKO_005 1854 CDS 100% 13.200 18.480 N Atxn1 n/a
2 TRCN0000175874 GTCGAAGTCTTGGTAGAGTAT pLKO.1 2635 CDS 100% 4.950 6.930 N Atxn1 n/a
3 TRCN0000216705 CAGAACCAGTACATCCATATT pLKO.1 1441 CDS 100% 13.200 9.240 N Atxn1 n/a
4 TRCN0000240655 AGACTACAGCAGTCGTGATAC pLKO_005 1815 CDS 100% 10.800 7.560 N Atxn1 n/a
5 TRCN0000240657 GGACCTGAAGACGGAGGATTT pLKO_005 2484 CDS 100% 10.800 7.560 N Atxn1 n/a
6 TRCN0000240654 TGCATCGAAGGCCGATCTAAC pLKO_005 3127 CDS 100% 10.800 7.560 N Atxn1 n/a
7 TRCN0000175574 CCCACTGGTTTCAAGAACAAA pLKO.1 3478 3UTR 100% 5.625 3.938 N Atxn1 n/a
8 TRCN0000173308 GCCGTGATACAGTTTGCTGTT pLKO.1 2590 CDS 100% 4.050 2.835 N Atxn1 n/a
9 TRCN0000240658 ACGTGGTTCTCTCCAACATAT pLKO_005 3720 3UTR 100% 13.200 7.920 N Atxn1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5793 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000432266 ATTACTGTACTGTAGGCTAAA pLKO_005 3212 3UTR 100% 10.800 7.560 N ATXN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01486 pDONR223 100% 83.5% 86.8% None (many diffs) n/a
2 ccsbBroad304_01486 pLX_304 0% 83.5% 86.8% V5 (many diffs) n/a
3 TRCN0000471549 CCTCCGTGCCGGGAGGAAACCGGA pLX_317 16% 83.5% 86.8% V5 (many diffs) n/a
Download CSV