Transcript: Human NM_001199388.2

Homo sapiens erythrocyte membrane protein band 4.1 like 2 (EPB41L2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
EPB41L2 (2037)
Length:
4023
CDS:
196..2754

Additional Resources:

NCBI RefSeq record:
NM_001199388.2
NBCI Gene record:
EPB41L2 (2037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199388.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117094 CCAAAGTCTTATGAAGGATTT pLKO.1 1875 CDS 100% 10.800 7.560 N EPB41L2 n/a
2 TRCN0000288856 CCAAAGTCTTATGAAGGATTT pLKO_005 1875 CDS 100% 10.800 7.560 N EPB41L2 n/a
3 TRCN0000117093 GCCTACTGAATTAGTAAGTAA pLKO.1 687 CDS 100% 5.625 3.938 N EPB41L2 n/a
4 TRCN0000288855 GCCTACTGAATTAGTAAGTAA pLKO_005 687 CDS 100% 5.625 3.938 N EPB41L2 n/a
5 TRCN0000117092 CCTATCTCTTTCAGATAGTTT pLKO.1 3725 3UTR 100% 0.563 0.394 N EPB41L2 n/a
6 TRCN0000288854 CCTATCTCTTTCAGATAGTTT pLKO_005 3725 3UTR 100% 0.563 0.394 N EPB41L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199388.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10802 pDONR223 100% 74.2% 73.3% None 1870delA;1901_2556del n/a
2 ccsbBroad304_10802 pLX_304 0% 74.2% 73.3% V5 1870delA;1901_2556del n/a
3 TRCN0000471036 TAGAGCCGATTGATCGTACCCGCC pLX_317 25.8% 74.2% 73.3% V5 1870delA;1901_2556del n/a
Download CSV