Transcript: Human NM_001199455.1

Homo sapiens bromodomain containing 2 (BRD2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
BRD2 (6046)
Length:
4602
CDS:
1305..3815

Additional Resources:

NCBI RefSeq record:
NM_001199455.1
NBCI Gene record:
BRD2 (6046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381007 GCTGCCCTATTCACTTCTAAG pLKO_005 4126 3UTR 100% 10.800 15.120 N BRD2 n/a
2 TRCN0000006309 GCCCTCTTTACGTGATTCAAA pLKO.1 3428 CDS 100% 5.625 7.875 N BRD2 n/a
3 TRCN0000315433 CCGGAAGCCCTACACCATTAA pLKO_005 3542 CDS 100% 13.200 10.560 N BRD2 n/a
4 TRCN0000023963 GCTTATGTTCTCCAACTGCTA pLKO.1 2561 CDS 100% 2.640 2.112 N Brd2 n/a
5 TRCN0000006311 CCTATGGACATGGGTACTATT pLKO.1 1662 CDS 100% 13.200 9.240 N BRD2 n/a
6 TRCN0000273643 CCTATGGACATGGGTACTATT pLKO_005 1662 CDS 100% 13.200 9.240 N BRD2 n/a
7 TRCN0000382148 GAAGATGGAGAACCGTGATTA pLKO_005 2507 CDS 100% 13.200 9.240 N BRD2 n/a
8 TRCN0000350645 GAGGGATGCAGGGACATTTAC pLKO_005 3962 3UTR 100% 13.200 9.240 N BRD2 n/a
9 TRCN0000350530 CTACCACTGTCCTCAACATTC pLKO_005 2005 CDS 100% 10.800 7.560 N BRD2 n/a
10 TRCN0000006310 CCCTGCCTACAGGTTATGATT pLKO.1 3286 CDS 100% 5.625 3.938 N BRD2 n/a
11 TRCN0000273689 CCCTGCCTACAGGTTATGATT pLKO_005 3286 CDS 100% 5.625 3.938 N BRD2 n/a
12 TRCN0000006312 CCTACCACTGTCCTCAACATT pLKO.1 2004 CDS 100% 5.625 3.938 N BRD2 n/a
13 TRCN0000006308 CCCTTTGCTGTGACACTTCTT pLKO.1 3891 3UTR 100% 4.950 3.465 N BRD2 n/a
14 TRCN0000195262 CTGATGATATTGTCCTAATGG pLKO.1 1780 CDS 100% 4.950 3.465 N BRD2 n/a
15 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 3171 CDS 100% 4.950 2.475 Y GTF2IRD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488280 TTCTCATGCTTAGATCCGTCTCCC pLX_317 12.2% 95.7% 95.8% V5 (not translated due to prior stop codon) 621C>T;1842_1946del n/a
Download CSV