Transcript: Human NM_001199583.2

Homo sapiens protein kinase C and casein kinase substrate in neurons 1 (PACSIN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
PACSIN1 (29993)
Length:
4332
CDS:
261..1595

Additional Resources:

NCBI RefSeq record:
NM_001199583.2
NBCI Gene record:
PACSIN1 (29993)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038015 CGCCTATCACAAGCAGATCAT pLKO.1 617 CDS 100% 4.950 6.930 N PACSIN1 n/a
2 TRCN0000421893 CCGTCTATGCAACGACCTGAT pLKO_005 368 CDS 100% 4.050 5.670 N PACSIN1 n/a
3 TRCN0000088843 GCCATAGAGTTCCAGACATAT pLKO.1 1672 3UTR 100% 13.200 10.560 N Pacsin1 n/a
4 TRCN0000038014 GCCTACCATTTGGCTTGCAAA pLKO.1 735 CDS 100% 4.950 3.465 N PACSIN1 n/a
5 TRCN0000038016 GTGAAGAACAATCTGCTGAAT pLKO.1 561 CDS 100% 4.950 3.465 N PACSIN1 n/a
6 TRCN0000433845 TGAACAGCAAGACGGAGCAAT pLKO_005 784 CDS 100% 4.950 3.465 N PACSIN1 n/a
7 TRCN0000038017 TGTGCAGAAGACACAGGAGAA pLKO.1 863 CDS 100% 4.050 2.835 N PACSIN1 n/a
8 TRCN0000038018 CGGCAGTGTTAGCAGCTACGA pLKO.1 1292 CDS 100% 0.880 0.616 N PACSIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03126 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03126 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472315 CACCAAGAACGTCGCTTATTACGT pLX_317 36.4% 100% 100% V5 n/a
Download CSV