Transcript: Human NM_001199679.1

Homo sapiens TLC domain containing 4 (TLCD4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
TLCD4 (148534)
Length:
6921
CDS:
377..1168

Additional Resources:

NCBI RefSeq record:
NM_001199679.1
NBCI Gene record:
TLCD4 (148534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142173 GTATTCTTCATCGTGCGGATT pLKO.1 923 CDS 100% 4.050 5.670 N TLCD4 n/a
2 TRCN0000143944 CCTCATTATGGCTTCATGTAT pLKO.1 956 CDS 100% 5.625 3.938 N TLCD4 n/a
3 TRCN0000145293 GACAGATTATAGACCTCCTTA pLKO.1 2167 3UTR 100% 4.950 3.465 N TLCD4 n/a
4 TRCN0000145212 GATGAATGTCATGTGGATGAT pLKO.1 1060 CDS 100% 4.950 3.465 N TLCD4 n/a
5 TRCN0000141056 CATCAGACAAGAGAAAGCCAA pLKO.1 1117 CDS 100% 2.640 1.848 N TLCD4 n/a
6 TRCN0000139681 CCTCTTCTTGATGAGACCCAA pLKO.1 2416 3UTR 100% 2.640 1.848 N TLCD4 n/a
7 TRCN0000144780 CATCAAAGTCATCTCTCACAT pLKO.1 1099 CDS 100% 4.950 2.970 N TLCD4 n/a
8 TRCN0000145238 GCATACTACCTTGTACTGAAA pLKO.1 758 CDS 100% 4.950 2.475 Y TLCD4 n/a
9 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 1406 3UTR 100% 4.050 2.025 Y TLCD4 n/a
10 TRCN0000139893 GTGCTGGCATACATTGGGAAT pLKO.1 785 CDS 100% 4.050 2.025 Y TLCD4 n/a
11 TRCN0000140836 GCCATTCTTTGGTGGTTGGTA pLKO.1 546 CDS 100% 3.000 1.500 Y TLCD4 n/a
12 TRCN0000141547 CAGTGTTACCTGTATCAGCTT pLKO.1 403 CDS 100% 2.640 1.320 Y TLCD4 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1335 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1503 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05015 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05015 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466221 GCACCCTCTATACCCCATTCGTTC pLX_317 45.5% 100% 100% V5 n/a
Download CSV