Transcript: Human NM_001199723.1

Homo sapiens cellular retinoic acid binding protein 2 (CRABP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CRABP2 (1382)
Length:
1075
CDS:
209..625

Additional Resources:

NCBI RefSeq record:
NM_001199723.1
NBCI Gene record:
CRABP2 (1382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021371 GAAATGGGAGAGTGAGAATAA pLKO.1 466 CDS 100% 13.200 9.240 N CRABP2 n/a
2 TRCN0000349588 GAAATGGGAGAGTGAGAATAA pLKO_005 466 CDS 100% 13.200 9.240 N CRABP2 n/a
3 TRCN0000021373 TCAAACAGGAGGGAGACACTT pLKO.1 339 CDS 100% 4.950 3.465 N CRABP2 n/a
4 TRCN0000318903 TCAAACAGGAGGGAGACACTT pLKO_005 339 CDS 100% 4.950 3.465 N CRABP2 n/a
5 TRCN0000021369 ACAGAGATTAACTTCAAGGTT pLKO.1 392 CDS 100% 3.000 2.100 N CRABP2 n/a
6 TRCN0000318906 ACAGAGATTAACTTCAAGGTT pLKO_005 392 CDS 100% 3.000 2.100 N CRABP2 n/a
7 TRCN0000021370 CGAGGAATTGCTCAAAGTGCT pLKO.1 256 CDS 100% 2.640 1.848 N CRABP2 n/a
8 TRCN0000349587 CGAGGAATTGCTCAAAGTGCT pLKO_005 256 CDS 100% 2.640 1.848 N CRABP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13837 pDONR223 100% 99.5% 98.5% None 404A>C;412G>A n/a
2 ccsbBroad304_13837 pLX_304 0% 99.5% 98.5% V5 404A>C;412G>A n/a
3 TRCN0000474042 ACATCCTCAACGCGACCGGTCTAC pLX_317 91.4% 99.5% 98.5% V5 404A>C;412G>A n/a
Download CSV