Transcript: Human NM_001199777.2

Homo sapiens POC1 centriolar protein B (POC1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
POC1B (282809)
Length:
3083
CDS:
338..1648

Additional Resources:

NCBI RefSeq record:
NM_001199777.2
NBCI Gene record:
POC1B (282809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077996 GCGGTGGAGTTAATTGCATAT pLKO.1 894 CDS 100% 10.800 15.120 N POC1B n/a
2 TRCN0000426451 AGTTGAGACTGTAGAAATTAA pLKO_005 1228 CDS 100% 15.000 10.500 N POC1B n/a
3 TRCN0000435327 GCAGACACACAGGTCTTATTA pLKO_005 1079 CDS 100% 15.000 10.500 N POC1B n/a
4 TRCN0000425473 GCATACCTAAGGACTAATTTA pLKO_005 1808 3UTR 100% 15.000 10.500 N POC1B n/a
5 TRCN0000430683 TTCCGTTGGATTTGCAAATTT pLKO_005 763 CDS 100% 15.000 10.500 N POC1B n/a
6 TRCN0000077993 GCCTTGAAAGAATGAACAAAT pLKO.1 2152 3UTR 100% 13.200 9.240 N POC1B n/a
7 TRCN0000432927 GTATTCCTTGTATCGACATAC pLKO_005 622 CDS 100% 10.800 7.560 N POC1B n/a
8 TRCN0000077997 CCACAAATAAGCAATGTGTTA pLKO.1 729 CDS 100% 4.950 3.465 N POC1B n/a
9 TRCN0000077994 CCTTCCTTAATGTCACCAGAA pLKO.1 1391 CDS 100% 4.050 2.835 N POC1B n/a
10 TRCN0000077995 GCGTTATTTCAAAGGCCACAA pLKO.1 244 5UTR 100% 4.050 2.025 Y POC1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05343 pDONR223 100% 91.2% 91.2% None 0_1ins126 n/a
2 ccsbBroad304_05343 pLX_304 0% 91.2% 91.2% V5 0_1ins126 n/a
3 TRCN0000481326 TACTACCCGCTTTAATTGCCCTGT pLX_317 28% 91.2% 91.2% V5 0_1ins126 n/a
Download CSV