Transcript: Human NM_001199821.1

Homo sapiens magnesium dependent phosphatase 1 (MDP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MDP1 (145553)
Length:
620
CDS:
116..484

Additional Resources:

NCBI RefSeq record:
NM_001199821.1
NBCI Gene record:
MDP1 (145553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146571 CCAGAATGGAATGAATCTTCA pLKO.1 398 CDS 100% 4.950 2.475 Y MDP1 n/a
2 TRCN0000149258 GCTTCAAGGACAAGTGAGATA pLKO.1 317 CDS 100% 4.950 2.475 Y MDP1 n/a
3 TRCN0000148437 CTCTAAGTCAAGGGTTAGAGA pLKO.1 421 CDS 100% 0.300 0.150 Y MDP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04977 pDONR223 100% 69.3% 45.2% None 262_263ins140;366_367ins22 n/a
2 ccsbBroad304_04977 pLX_304 0% 69.3% 45.2% V5 262_263ins140;366_367ins22 n/a
3 TRCN0000478768 GCACCCATTTAACACCACGAGACA pLX_317 70% 69.3% 45.2% V5 262_263ins140;366_367ins22 n/a
Download CSV