Transcript: Human NM_001199839.1

Homo sapiens BCL2 like 2 (BCL2L2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
BCL2L2 (599)
Length:
3576
CDS:
185..766

Additional Resources:

NCBI RefSeq record:
NM_001199839.1
NBCI Gene record:
BCL2L2 (599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426083 CCATTAGATGAGTGGGATTTA pLKO_005 1116 3UTR 100% 13.200 18.480 N BCL2L2 n/a
2 TRCN0000430161 GAGGAAGGTGGACTTACATAA pLKO_005 1084 3UTR 100% 13.200 9.240 N BCL2L2 n/a
3 TRCN0000321105 GGCGGAGTTCACAGCTCTATA pLKO_005 616 CDS 100% 13.200 9.240 N Bcl2l2 n/a
4 TRCN0000435128 TTGCTAGCAAGTGAAAGTCCA pLKO_005 753 CDS 100% 2.640 1.848 N BCL2L2 n/a
5 TRCN0000033506 TGGGCGGAGTTCACAGCTCTA pLKO.1 614 CDS 100% 1.350 0.945 N BCL2L2 n/a
6 TRCN0000033504 TGGCAGACTTTGTAGGTTATA pLKO.1 225 CDS 100% 13.200 6.600 Y BCL2L2 n/a
7 TRCN0000033508 CCCAGGTCTCCGATGAACTTT pLKO.1 423 CDS 100% 5.625 2.813 Y BCL2L2 n/a
8 TRCN0000033507 CAGAAGGGTTATGTCTGTGGA pLKO.1 254 CDS 100% 2.640 1.320 Y BCL2L2 n/a
9 TRCN0000033505 GTCAACAAGGAGATGGAACCA pLKO.1 515 CDS 100% 2.640 1.320 Y BCL2L2 n/a
10 TRCN0000437498 AGCTGGAGATGAGTTCGAGAC pLKO_005 328 CDS 100% 2.250 1.125 Y BCL2L2 n/a
11 TRCN0000321106 GTGCTGAGAGTGTCAACAAAG pLKO_005 504 CDS 100% 10.800 5.400 Y Bcl2l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05881 pDONR223 100% 99.8% 100% None 123G>A n/a
2 ccsbBroad304_05881 pLX_304 0% 99.8% 100% V5 123G>A n/a
3 TRCN0000466971 TTAAGTTAGCCAGTTCCTGTGTAT pLX_317 49.5% 99.8% 100% V5 123G>A n/a
Download CSV