Transcript: Human NM_001199875.1

Homo sapiens small EDRK-rich factor 2 (SERF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
SERF2 (10169)
Length:
3048
CDS:
402..914

Additional Resources:

NCBI RefSeq record:
NM_001199875.1
NBCI Gene record:
SERF2 (10169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000292403 GTGGGTATGTAGACTTAATAA pLKO_005 1086 3UTR 100% 15.000 12.000 N SERF2 n/a
2 TRCN0000181056 CAAACGAGAAGAAGGAGGAAC pLKO.1 687 CDS 100% 4.050 2.835 N SERF2 n/a
3 TRCN0000180615 GATCATGCAGCAGAAGCAGAA pLKO.1 661 CDS 100% 4.050 2.835 N SERF2 n/a
4 TRCN0000292475 GATCATGCAGCAGAAGCAGAA pLKO_005 661 CDS 100% 4.050 2.835 N SERF2 n/a
5 TRCN0000248857 TCGGAGATCATGCAGCAGAAG pLKO_005 656 CDS 100% 4.050 2.835 N Serf2 n/a
6 TRCN0000180036 CAAGTAGCTTTGTGGCTTCGT pLKO.1 709 CDS 100% 2.640 1.848 N SERF2 n/a
7 TRCN0000292476 CAAGTAGCTTTGTGGCTTCGT pLKO_005 709 CDS 100% 2.640 1.848 N SERF2 n/a
8 TRCN0000180405 GAAGAAGGAGGAACCCAAGTA pLKO.1 694 CDS 100% 4.950 2.970 N SERF2 n/a
9 TRCN0000248854 GAAGAAGGAGGAACCCAAGTA pLKO_005 694 CDS 100% 4.950 2.970 N Serf2 n/a
10 TRCN0000292452 GAAGAAGGAGGAACCCAAGTA pLKO_005 694 CDS 100% 4.950 2.970 N SERF2 n/a
11 TRCN0000292404 AGCGACTCGGTTAAGGGAAAG pLKO_005 456 CDS 100% 6.000 3.000 Y SERF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11463 pDONR223 100% 57.6% 52% None 1_82del;115_248del n/a
2 ccsbBroad304_11463 pLX_304 0% 57.6% 52% V5 1_82del;115_248del n/a
3 TRCN0000468723 CTTGAGGTAACTACCAGAGTAATG pLX_317 92.9% 57.6% 52% V5 1_82del;115_248del n/a
Download CSV