Transcript: Human NM_001199888.1

Homo sapiens interleukin 7 (IL7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-29
Taxon:
Homo sapiens (human)
Gene:
IL7 (3574)
Length:
1903
CDS:
602..949

Additional Resources:

NCBI RefSeq record:
NM_001199888.1
NBCI Gene record:
IL7 (3574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059184 CGATCAATTATTGGACAGCAT pLKO.1 736 CDS 100% 2.640 3.696 N IL7 n/a
2 TRCN0000372729 GCTCACTATGAATCTATTATA pLKO_005 1351 3UTR 100% 15.000 10.500 N IL7 n/a
3 TRCN0000059186 GTGTTTCCTAAAGAGACTATT pLKO.1 874 CDS 100% 13.200 9.240 N IL7 n/a
4 TRCN0000372672 TAAGGTATCAGTTGCAATAAT pLKO_005 1225 3UTR 100% 15.000 9.000 N IL7 n/a
5 TRCN0000059185 GCATCATCTGATTGTGATATT pLKO.1 668 CDS 100% 13.200 7.920 N IL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00852 pDONR223 100% 64.9% 64.9% None 227_228ins186 n/a
2 ccsbBroad304_00852 pLX_304 0% 64.9% 64.9% V5 227_228ins186 n/a
3 TRCN0000472386 TTAATTATGACCACTACTTCATCA pLX_317 85.8% 64.9% 64.9% V5 227_228ins186 n/a
Download CSV